From 99e937efcf7d2f167442e13241058d58a58f2915 Mon Sep 17 00:00:00 2001
From: "anodelman%mozilla.com"
 <anodelman%mozilla.com@18797224-902f-48f8-a5cc-f745e15eee43>
Date: Tue, 22 Jan 2008 22:24:01 +0000
Subject: [PATCH] Bug 396574 - Javascript Speed Tests, initial pass at getting
 all tests correctly formatted for talos and checked in a=jresig/anodelman
 r=jresig

git-svn-id: svn://10.0.0.236/trunk@243757 18797224-902f-48f8-a5cc-f745e15eee43
---
 .../talos/page_load_test/jss/core-eval-1.html |  57 +++
 .../page_load_test/jss/core-eval-10.html      |  57 +++
 .../page_load_test/jss/core-eval-11.html      |  57 +++
 .../page_load_test/jss/core-eval-12.html      |  57 +++
 .../page_load_test/jss/core-eval-13.html      |  57 +++
 .../page_load_test/jss/core-eval-14.html      |  57 +++
 .../page_load_test/jss/core-eval-15.html      |  57 +++
 .../page_load_test/jss/core-eval-16.html      |  57 +++
 .../talos/page_load_test/jss/core-eval-2.html |  57 +++
 .../talos/page_load_test/jss/core-eval-3.html |  57 +++
 .../talos/page_load_test/jss/core-eval-4.html |  57 +++
 .../talos/page_load_test/jss/core-eval-5.html |  57 +++
 .../talos/page_load_test/jss/core-eval-6.html |  57 +++
 .../talos/page_load_test/jss/core-eval-7.html |  57 +++
 .../talos/page_load_test/jss/core-eval-8.html |  57 +++
 .../talos/page_load_test/jss/core-eval-9.html |  57 +++
 .../talos/page_load_test/jss/jss.manifest     | 334 +++++++++++++++++
 .../page_load_test/jss/object-array-1.html    |  68 ++++
 .../page_load_test/jss/object-array-10.html   |  68 ++++
 .../page_load_test/jss/object-array-11.html   |  68 ++++
 .../page_load_test/jss/object-array-12.html   |  68 ++++
 .../page_load_test/jss/object-array-13.html   |  68 ++++
 .../page_load_test/jss/object-array-14.html   |  68 ++++
 .../page_load_test/jss/object-array-15.html   |  68 ++++
 .../page_load_test/jss/object-array-16.html   |  68 ++++
 .../page_load_test/jss/object-array-17.html   |  68 ++++
 .../page_load_test/jss/object-array-18.html   |  68 ++++
 .../page_load_test/jss/object-array-19.html   |  68 ++++
 .../page_load_test/jss/object-array-2.html    |  68 ++++
 .../page_load_test/jss/object-array-20.html   |  68 ++++
 .../page_load_test/jss/object-array-21.html   |  68 ++++
 .../page_load_test/jss/object-array-22.html   |  68 ++++
 .../page_load_test/jss/object-array-23.html   |  68 ++++
 .../page_load_test/jss/object-array-24.html   |  68 ++++
 .../page_load_test/jss/object-array-25.html   |  68 ++++
 .../page_load_test/jss/object-array-26.html   |  68 ++++
 .../page_load_test/jss/object-array-27.html   |  68 ++++
 .../page_load_test/jss/object-array-28.html   |  68 ++++
 .../page_load_test/jss/object-array-29.html   |  68 ++++
 .../page_load_test/jss/object-array-3.html    |  68 ++++
 .../page_load_test/jss/object-array-30.html   |  68 ++++
 .../page_load_test/jss/object-array-31.html   |  68 ++++
 .../page_load_test/jss/object-array-32.html   |  68 ++++
 .../page_load_test/jss/object-array-4.html    |  68 ++++
 .../page_load_test/jss/object-array-5.html    |  68 ++++
 .../page_load_test/jss/object-array-6.html    |  68 ++++
 .../page_load_test/jss/object-array-7.html    |  68 ++++
 .../page_load_test/jss/object-array-8.html    |  68 ++++
 .../page_load_test/jss/object-array-9.html    |  68 ++++
 .../page_load_test/jss/object-regexp-1.html   | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-10.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-100.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-101.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-102.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-103.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-104.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-105.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-106.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-107.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-108.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-109.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-11.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-110.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-111.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-112.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-113.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-114.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-115.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-116.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-117.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-118.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-119.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-12.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-120.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-121.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-122.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-123.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-124.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-125.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-126.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-127.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-128.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-129.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-13.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-130.html | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-14.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-15.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-16.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-17.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-18.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-19.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-2.html   | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-20.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-21.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-22.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-23.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-24.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-25.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-26.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-27.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-28.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-29.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-3.html   | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-30.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-31.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-32.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-33.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-34.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-35.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-36.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-37.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-38.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-39.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-4.html   | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-40.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-41.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-42.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-43.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-44.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-45.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-46.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-47.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-48.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-49.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-5.html   | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-50.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-51.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-52.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-53.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-54.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-55.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-56.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-57.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-58.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-59.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-6.html   | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-60.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-61.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-62.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-63.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-64.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-65.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-66.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-67.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-68.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-69.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-7.html   | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-70.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-71.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-72.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-73.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-74.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-75.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-76.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-77.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-78.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-79.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-8.html   | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-80.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-81.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-82.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-83.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-84.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-85.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-86.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-87.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-88.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-89.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-9.html   | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-90.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-91.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-92.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-93.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-94.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-95.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-96.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-97.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-98.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-regexp-99.html  | 264 ++++++++++++++
 .../page_load_test/jss/object-string-1.html   | 222 +++++++++++
 .../page_load_test/jss/object-string-10.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-11.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-12.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-13.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-14.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-15.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-16.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-17.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-18.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-19.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-2.html   | 222 +++++++++++
 .../page_load_test/jss/object-string-20.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-21.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-22.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-23.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-24.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-25.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-26.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-27.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-28.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-29.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-3.html   | 222 +++++++++++
 .../page_load_test/jss/object-string-30.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-31.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-32.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-33.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-34.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-35.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-36.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-37.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-38.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-39.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-4.html   | 222 +++++++++++
 .../page_load_test/jss/object-string-40.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-41.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-42.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-43.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-44.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-45.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-46.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-47.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-48.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-49.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-5.html   | 222 +++++++++++
 .../page_load_test/jss/object-string-50.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-51.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-52.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-53.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-54.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-55.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-56.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-57.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-58.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-59.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-6.html   | 222 +++++++++++
 .../page_load_test/jss/object-string-60.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-61.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-62.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-63.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-64.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-65.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-66.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-67.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-68.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-69.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-7.html   | 222 +++++++++++
 .../page_load_test/jss/object-string-70.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-71.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-72.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-73.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-74.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-75.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-76.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-77.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-78.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-79.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-8.html   | 222 +++++++++++
 .../page_load_test/jss/object-string-80.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-81.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-82.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-83.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-84.html  | 222 +++++++++++
 .../page_load_test/jss/object-string-9.html   | 222 +++++++++++
 .../page_load_test/jss/real-base64-1.html     | 155 ++++++++
 .../page_load_test/jss/real-base64-2.html     | 155 ++++++++
 .../page_load_test/jss/real-base64-3.html     | 155 ++++++++
 .../page_load_test/jss/real-base64-4.html     | 155 ++++++++
 .../page_load_test/jss/real-base64-5.html     | 155 ++++++++
 .../page_load_test/jss/real-base64-6.html     | 155 ++++++++
 .../page_load_test/jss/real-base64-7.html     | 155 ++++++++
 .../page_load_test/jss/real-base64-8.html     | 155 ++++++++
 .../jss/real-binary-trees-1.html              |  66 ++++
 .../jss/real-binary-trees-2.html              |  66 ++++
 .../jss/real-binary-trees-3.html              |  66 ++++
 .../talos/page_load_test/jss/real-cube-1.html | 344 ++++++++++++++++++
 .../talos/page_load_test/jss/real-cube-2.html | 344 ++++++++++++++++++
 .../talos/page_load_test/jss/real-cube-3.html | 344 ++++++++++++++++++
 .../talos/page_load_test/jss/real-cube-4.html | 344 ++++++++++++++++++
 .../page_load_test/jss/real-fannkuch-1.html   |  84 +++++
 .../page_load_test/jss/real-fannkuch-2.html   |  84 +++++
 .../page_load_test/jss/real-fannkuch-3.html   |  84 +++++
 .../page_load_test/jss/real-fannkuch-4.html   |  84 +++++
 .../page_load_test/jss/real-fasta-1.html      | 107 ++++++
 .../page_load_test/jss/real-fasta-10.html     | 107 ++++++
 .../page_load_test/jss/real-fasta-11.html     | 107 ++++++
 .../page_load_test/jss/real-fasta-12.html     | 107 ++++++
 .../page_load_test/jss/real-fasta-2.html      | 107 ++++++
 .../page_load_test/jss/real-fasta-3.html      | 107 ++++++
 .../page_load_test/jss/real-fasta-4.html      | 107 ++++++
 .../page_load_test/jss/real-fasta-5.html      | 107 ++++++
 .../page_load_test/jss/real-fasta-6.html      | 107 ++++++
 .../page_load_test/jss/real-fasta-7.html      | 107 ++++++
 .../page_load_test/jss/real-fasta-8.html      | 107 ++++++
 .../page_load_test/jss/real-fasta-9.html      | 107 ++++++
 .../page_load_test/jss/real-morph-1.html      |  44 +++
 .../page_load_test/jss/real-morph-2.html      |  44 +++
 .../page_load_test/jss/real-morph-3.html      |  44 +++
 .../page_load_test/jss/real-morph-4.html      |  44 +++
 .../page_load_test/jss/real-nbody-1.html      | 183 ++++++++++
 .../page_load_test/jss/real-nbody-2.html      | 183 ++++++++++
 .../page_load_test/jss/real-nbody-3.html      | 183 ++++++++++
 .../page_load_test/jss/real-nbody-4.html      | 183 ++++++++++
 .../page_load_test/jss/real-nsieve-1.html     |  50 +++
 .../page_load_test/jss/real-nsieve-2.html     |  50 +++
 .../page_load_test/jss/real-nsieve-3.html     |  50 +++
 .../page_load_test/jss/real-nsieve-4.html     |  50 +++
 .../jss/real-nsieve-bits-1.html               |  44 +++
 .../jss/real-nsieve-bits-2.html               |  44 +++
 .../jss/real-nsieve-bits-3.html               |  44 +++
 .../jss/real-nsieve-bits-4.html               |  44 +++
 .../page_load_test/jss/real-packer-1.html     |  33 ++
 .../page_load_test/jss/real-packer-2.html     |  33 ++
 .../page_load_test/jss/real-packer-3.html     |  33 ++
 .../page_load_test/jss/real-packer-4.html     |  33 ++
 .../page_load_test/jss/real-packer-5.html     |  33 ++
 .../jss/real-partial-sums-1.html              |  48 +++
 .../jss/real-partial-sums-2.html              |  48 +++
 .../jss/real-partial-sums-3.html              |  48 +++
 .../jss/real-partial-sums-4.html              |  48 +++
 .../page_load_test/jss/real-recursive-1.html  |  49 +++
 .../page_load_test/jss/real-recursive-10.html |  49 +++
 .../page_load_test/jss/real-recursive-11.html |  49 +++
 .../page_load_test/jss/real-recursive-12.html |  49 +++
 .../page_load_test/jss/real-recursive-2.html  |  49 +++
 .../page_load_test/jss/real-recursive-3.html  |  49 +++
 .../page_load_test/jss/real-recursive-4.html  |  49 +++
 .../page_load_test/jss/real-recursive-5.html  |  49 +++
 .../page_load_test/jss/real-recursive-6.html  |  49 +++
 .../page_load_test/jss/real-recursive-7.html  |  49 +++
 .../page_load_test/jss/real-recursive-8.html  |  49 +++
 .../page_load_test/jss/real-recursive-9.html  |  49 +++
 .../jss/real-spectral-norm-1.html             |  67 ++++
 .../jss/real-spectral-norm-2.html             |  67 ++++
 .../jss/real-spectral-norm-3.html             |  67 ++++
 .../jss/real-spectral-norm-4.html             |  67 ++++
 .../talos/page_load_test/jss/runner.js        | 172 +++++++++
 .../testing/performance/talos/sample.config   |   6 +
 337 files changed, 63499 insertions(+)
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-10.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-11.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-12.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-13.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-14.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-15.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-16.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-5.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-6.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-7.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-8.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/core-eval-9.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/jss.manifest
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-10.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-11.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-12.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-13.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-14.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-15.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-16.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-17.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-18.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-19.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-20.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-21.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-22.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-23.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-24.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-25.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-26.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-27.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-28.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-29.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-30.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-31.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-32.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-5.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-6.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-7.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-8.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-array-9.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-10.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-100.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-101.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-102.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-103.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-104.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-105.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-106.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-107.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-108.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-109.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-11.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-110.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-111.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-112.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-113.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-114.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-115.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-116.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-117.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-118.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-119.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-12.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-120.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-121.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-122.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-123.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-124.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-125.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-126.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-127.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-128.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-129.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-13.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-130.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-14.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-15.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-16.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-17.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-18.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-19.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-20.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-21.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-22.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-23.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-24.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-25.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-26.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-27.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-28.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-29.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-30.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-31.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-32.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-33.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-34.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-35.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-36.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-37.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-38.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-39.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-40.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-41.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-42.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-43.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-44.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-45.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-46.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-47.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-48.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-49.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-5.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-50.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-51.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-52.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-53.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-54.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-55.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-56.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-57.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-58.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-59.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-6.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-60.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-61.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-62.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-63.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-64.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-65.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-66.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-67.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-68.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-69.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-7.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-70.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-71.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-72.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-73.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-74.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-75.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-76.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-77.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-78.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-79.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-8.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-80.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-81.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-82.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-83.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-84.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-85.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-86.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-87.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-88.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-89.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-9.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-90.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-91.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-92.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-93.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-94.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-95.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-96.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-97.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-98.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-regexp-99.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-10.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-11.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-12.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-13.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-14.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-15.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-16.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-17.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-18.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-19.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-20.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-21.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-22.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-23.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-24.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-25.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-26.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-27.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-28.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-29.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-30.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-31.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-32.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-33.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-34.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-35.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-36.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-37.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-38.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-39.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-40.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-41.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-42.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-43.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-44.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-45.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-46.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-47.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-48.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-49.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-5.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-50.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-51.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-52.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-53.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-54.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-55.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-56.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-57.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-58.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-59.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-6.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-60.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-61.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-62.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-63.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-64.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-65.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-66.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-67.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-68.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-69.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-7.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-70.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-71.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-72.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-73.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-74.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-75.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-76.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-77.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-78.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-79.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-8.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-80.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-81.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-82.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-83.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-84.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/object-string-9.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-base64-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-base64-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-base64-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-base64-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-base64-5.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-base64-6.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-base64-7.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-base64-8.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-cube-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-cube-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-cube-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-cube-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-10.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-11.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-12.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-5.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-6.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-7.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-8.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-fasta-9.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-morph-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-morph-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-morph-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-morph-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nbody-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nbody-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nbody-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nbody-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-packer-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-packer-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-packer-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-packer-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-packer-5.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-10.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-11.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-12.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-5.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-6.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-7.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-8.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-recursive-9.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-1.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-2.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-3.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-4.html
 create mode 100644 mozilla/testing/performance/talos/page_load_test/jss/runner.js

diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-1.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-1.html
new file mode 100644
index 00000000000..692fb696b5a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-1.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'No eval', onlyNum = 1;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-10.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-10.html
new file mode 100644
index 00000000000..f7647bd7087
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-10.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Normal eval', onlyNum = 4;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-11.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-11.html
new file mode 100644
index 00000000000..210996b2aef
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-11.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'new Function', onlyNum = 4;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-12.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-12.html
new file mode 100644
index 00000000000..65a495dfddd
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-12.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Pre-Compiled Function', onlyNum = 4;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-13.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-13.html
new file mode 100644
index 00000000000..3b004aa3b7a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-13.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'No eval', onlyNum = 8;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-14.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-14.html
new file mode 100644
index 00000000000..1b73d62c89f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-14.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Normal eval', onlyNum = 8;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-15.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-15.html
new file mode 100644
index 00000000000..a1fb07105e8
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-15.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'new Function', onlyNum = 8;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-16.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-16.html
new file mode 100644
index 00000000000..17c311a7d40
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-16.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Pre-Compiled Function', onlyNum = 8;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-2.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-2.html
new file mode 100644
index 00000000000..1544e5e08a0
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-2.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Normal eval', onlyNum = 1;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-3.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-3.html
new file mode 100644
index 00000000000..6e096b2ac49
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-3.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'new Function', onlyNum = 1;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-4.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-4.html
new file mode 100644
index 00000000000..5e5880656cb
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-4.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Pre-Compiled Function', onlyNum = 1;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-5.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-5.html
new file mode 100644
index 00000000000..7eab179c40b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-5.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'No eval', onlyNum = 2;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-6.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-6.html
new file mode 100644
index 00000000000..5b3cd137a77
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-6.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Normal eval', onlyNum = 2;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-7.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-7.html
new file mode 100644
index 00000000000..e7fe918312e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-7.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'new Function', onlyNum = 2;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-8.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-8.html
new file mode 100644
index 00000000000..fb2ba3ca6c4
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-8.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Pre-Compiled Function', onlyNum = 2;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/core-eval-9.html b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-9.html
new file mode 100644
index 00000000000..0f13732c409
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/core-eval-9.html
@@ -0,0 +1,57 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'No eval', onlyNum = 4;
+function thisTest() {
+
+startTest("core-eval");
+
+// Try to force real results
+var ret, tmp;
+
+// The commands that we'll be evaling
+var cmd = 'var str="";for(var i=0;i<10;i++){str += "a";}ret = str;';
+
+// TESTS: eval()
+
+for ( var num = 1; num <= 8; num *= 2 ) (function(num){
+
+	test( "No eval", num, function(){
+		for ( var n = 0; n < num; n++ ) {
+			var str = "";
+			for ( var i = 0; i < 100; i++ ) {
+				str += "a";
+			}
+			ret = str;
+		}
+	});
+
+	tmp = cmd;
+
+	for ( var n = 0; n < num; n++ )
+		tmp += tmp;
+
+	test( "Normal eval", num, function(){
+		eval(tmp);
+	});
+
+	test( "new Function", num, function(){
+		(new Function(tmp))();
+	});
+
+	var fn;
+	try {
+	   fn = new Function(tmp);
+	} catch(e){}
+
+	test( "Pre-Compiled Function", num, function(){
+		fn();
+	});
+
+})(num);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/jss.manifest b/mozilla/testing/performance/talos/page_load_test/jss/jss.manifest
new file mode 100644
index 00000000000..c202f3cc71b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/jss.manifest
@@ -0,0 +1,334 @@
+% http://localhost/page_load_test/jss/core-eval-1.html
+% http://localhost/page_load_test/jss/core-eval-10.html
+% http://localhost/page_load_test/jss/core-eval-11.html
+% http://localhost/page_load_test/jss/core-eval-12.html
+% http://localhost/page_load_test/jss/core-eval-13.html
+% http://localhost/page_load_test/jss/core-eval-14.html
+% http://localhost/page_load_test/jss/core-eval-15.html
+% http://localhost/page_load_test/jss/core-eval-16.html
+% http://localhost/page_load_test/jss/core-eval-2.html
+% http://localhost/page_load_test/jss/core-eval-3.html
+% http://localhost/page_load_test/jss/core-eval-4.html
+% http://localhost/page_load_test/jss/core-eval-5.html
+% http://localhost/page_load_test/jss/core-eval-6.html
+% http://localhost/page_load_test/jss/core-eval-7.html
+% http://localhost/page_load_test/jss/core-eval-8.html
+% http://localhost/page_load_test/jss/core-eval-9.html
+% http://localhost/page_load_test/jss/object-array-1.html
+% http://localhost/page_load_test/jss/object-array-10.html
+% http://localhost/page_load_test/jss/object-array-11.html
+% http://localhost/page_load_test/jss/object-array-12.html
+% http://localhost/page_load_test/jss/object-array-13.html
+% http://localhost/page_load_test/jss/object-array-14.html
+% http://localhost/page_load_test/jss/object-array-15.html
+% http://localhost/page_load_test/jss/object-array-16.html
+% http://localhost/page_load_test/jss/object-array-17.html
+% http://localhost/page_load_test/jss/object-array-18.html
+% http://localhost/page_load_test/jss/object-array-19.html
+% http://localhost/page_load_test/jss/object-array-2.html
+% http://localhost/page_load_test/jss/object-array-20.html
+% http://localhost/page_load_test/jss/object-array-21.html
+% http://localhost/page_load_test/jss/object-array-22.html
+% http://localhost/page_load_test/jss/object-array-23.html
+% http://localhost/page_load_test/jss/object-array-24.html
+% http://localhost/page_load_test/jss/object-array-25.html
+% http://localhost/page_load_test/jss/object-array-26.html
+% http://localhost/page_load_test/jss/object-array-27.html
+% http://localhost/page_load_test/jss/object-array-28.html
+% http://localhost/page_load_test/jss/object-array-29.html
+% http://localhost/page_load_test/jss/object-array-3.html
+% http://localhost/page_load_test/jss/object-array-30.html
+% http://localhost/page_load_test/jss/object-array-31.html
+% http://localhost/page_load_test/jss/object-array-32.html
+% http://localhost/page_load_test/jss/object-array-4.html
+% http://localhost/page_load_test/jss/object-array-5.html
+% http://localhost/page_load_test/jss/object-array-6.html
+% http://localhost/page_load_test/jss/object-array-7.html
+% http://localhost/page_load_test/jss/object-array-8.html
+% http://localhost/page_load_test/jss/object-array-9.html
+% http://localhost/page_load_test/jss/object-regexp-1.html
+% http://localhost/page_load_test/jss/object-regexp-10.html
+% http://localhost/page_load_test/jss/object-regexp-100.html
+% http://localhost/page_load_test/jss/object-regexp-101.html
+% http://localhost/page_load_test/jss/object-regexp-102.html
+% http://localhost/page_load_test/jss/object-regexp-103.html
+% http://localhost/page_load_test/jss/object-regexp-104.html
+% http://localhost/page_load_test/jss/object-regexp-105.html
+% http://localhost/page_load_test/jss/object-regexp-106.html
+% http://localhost/page_load_test/jss/object-regexp-107.html
+% http://localhost/page_load_test/jss/object-regexp-108.html
+% http://localhost/page_load_test/jss/object-regexp-109.html
+% http://localhost/page_load_test/jss/object-regexp-11.html
+% http://localhost/page_load_test/jss/object-regexp-110.html
+% http://localhost/page_load_test/jss/object-regexp-111.html
+% http://localhost/page_load_test/jss/object-regexp-112.html
+% http://localhost/page_load_test/jss/object-regexp-113.html
+% http://localhost/page_load_test/jss/object-regexp-114.html
+% http://localhost/page_load_test/jss/object-regexp-115.html
+% http://localhost/page_load_test/jss/object-regexp-116.html
+% http://localhost/page_load_test/jss/object-regexp-117.html
+% http://localhost/page_load_test/jss/object-regexp-118.html
+% http://localhost/page_load_test/jss/object-regexp-119.html
+% http://localhost/page_load_test/jss/object-regexp-12.html
+% http://localhost/page_load_test/jss/object-regexp-120.html
+% http://localhost/page_load_test/jss/object-regexp-121.html
+% http://localhost/page_load_test/jss/object-regexp-122.html
+% http://localhost/page_load_test/jss/object-regexp-123.html
+% http://localhost/page_load_test/jss/object-regexp-124.html
+% http://localhost/page_load_test/jss/object-regexp-125.html
+% http://localhost/page_load_test/jss/object-regexp-126.html
+% http://localhost/page_load_test/jss/object-regexp-127.html
+% http://localhost/page_load_test/jss/object-regexp-128.html
+% http://localhost/page_load_test/jss/object-regexp-129.html
+% http://localhost/page_load_test/jss/object-regexp-13.html
+% http://localhost/page_load_test/jss/object-regexp-130.html
+% http://localhost/page_load_test/jss/object-regexp-14.html
+% http://localhost/page_load_test/jss/object-regexp-15.html
+% http://localhost/page_load_test/jss/object-regexp-16.html
+% http://localhost/page_load_test/jss/object-regexp-17.html
+% http://localhost/page_load_test/jss/object-regexp-18.html
+% http://localhost/page_load_test/jss/object-regexp-19.html
+% http://localhost/page_load_test/jss/object-regexp-2.html
+% http://localhost/page_load_test/jss/object-regexp-20.html
+% http://localhost/page_load_test/jss/object-regexp-21.html
+% http://localhost/page_load_test/jss/object-regexp-22.html
+% http://localhost/page_load_test/jss/object-regexp-23.html
+% http://localhost/page_load_test/jss/object-regexp-24.html
+% http://localhost/page_load_test/jss/object-regexp-25.html
+% http://localhost/page_load_test/jss/object-regexp-26.html
+% http://localhost/page_load_test/jss/object-regexp-27.html
+% http://localhost/page_load_test/jss/object-regexp-28.html
+% http://localhost/page_load_test/jss/object-regexp-29.html
+% http://localhost/page_load_test/jss/object-regexp-3.html
+% http://localhost/page_load_test/jss/object-regexp-30.html
+% http://localhost/page_load_test/jss/object-regexp-31.html
+% http://localhost/page_load_test/jss/object-regexp-32.html
+% http://localhost/page_load_test/jss/object-regexp-33.html
+% http://localhost/page_load_test/jss/object-regexp-34.html
+% http://localhost/page_load_test/jss/object-regexp-35.html
+% http://localhost/page_load_test/jss/object-regexp-36.html
+% http://localhost/page_load_test/jss/object-regexp-37.html
+% http://localhost/page_load_test/jss/object-regexp-38.html
+% http://localhost/page_load_test/jss/object-regexp-39.html
+% http://localhost/page_load_test/jss/object-regexp-4.html
+% http://localhost/page_load_test/jss/object-regexp-40.html
+% http://localhost/page_load_test/jss/object-regexp-41.html
+% http://localhost/page_load_test/jss/object-regexp-42.html
+% http://localhost/page_load_test/jss/object-regexp-43.html
+% http://localhost/page_load_test/jss/object-regexp-44.html
+% http://localhost/page_load_test/jss/object-regexp-45.html
+% http://localhost/page_load_test/jss/object-regexp-46.html
+% http://localhost/page_load_test/jss/object-regexp-47.html
+% http://localhost/page_load_test/jss/object-regexp-48.html
+% http://localhost/page_load_test/jss/object-regexp-49.html
+% http://localhost/page_load_test/jss/object-regexp-5.html
+% http://localhost/page_load_test/jss/object-regexp-50.html
+% http://localhost/page_load_test/jss/object-regexp-51.html
+% http://localhost/page_load_test/jss/object-regexp-52.html
+% http://localhost/page_load_test/jss/object-regexp-53.html
+% http://localhost/page_load_test/jss/object-regexp-54.html
+% http://localhost/page_load_test/jss/object-regexp-55.html
+% http://localhost/page_load_test/jss/object-regexp-56.html
+% http://localhost/page_load_test/jss/object-regexp-57.html
+% http://localhost/page_load_test/jss/object-regexp-58.html
+% http://localhost/page_load_test/jss/object-regexp-59.html
+% http://localhost/page_load_test/jss/object-regexp-6.html
+% http://localhost/page_load_test/jss/object-regexp-60.html
+% http://localhost/page_load_test/jss/object-regexp-61.html
+% http://localhost/page_load_test/jss/object-regexp-62.html
+% http://localhost/page_load_test/jss/object-regexp-63.html
+% http://localhost/page_load_test/jss/object-regexp-64.html
+% http://localhost/page_load_test/jss/object-regexp-65.html
+% http://localhost/page_load_test/jss/object-regexp-66.html
+% http://localhost/page_load_test/jss/object-regexp-67.html
+% http://localhost/page_load_test/jss/object-regexp-68.html
+% http://localhost/page_load_test/jss/object-regexp-69.html
+% http://localhost/page_load_test/jss/object-regexp-7.html
+% http://localhost/page_load_test/jss/object-regexp-70.html
+% http://localhost/page_load_test/jss/object-regexp-71.html
+% http://localhost/page_load_test/jss/object-regexp-72.html
+% http://localhost/page_load_test/jss/object-regexp-73.html
+% http://localhost/page_load_test/jss/object-regexp-74.html
+% http://localhost/page_load_test/jss/object-regexp-75.html
+% http://localhost/page_load_test/jss/object-regexp-76.html
+% http://localhost/page_load_test/jss/object-regexp-77.html
+% http://localhost/page_load_test/jss/object-regexp-78.html
+% http://localhost/page_load_test/jss/object-regexp-79.html
+% http://localhost/page_load_test/jss/object-regexp-8.html
+% http://localhost/page_load_test/jss/object-regexp-80.html
+% http://localhost/page_load_test/jss/object-regexp-81.html
+% http://localhost/page_load_test/jss/object-regexp-82.html
+% http://localhost/page_load_test/jss/object-regexp-83.html
+% http://localhost/page_load_test/jss/object-regexp-84.html
+% http://localhost/page_load_test/jss/object-regexp-85.html
+% http://localhost/page_load_test/jss/object-regexp-86.html
+% http://localhost/page_load_test/jss/object-regexp-87.html
+% http://localhost/page_load_test/jss/object-regexp-88.html
+% http://localhost/page_load_test/jss/object-regexp-89.html
+% http://localhost/page_load_test/jss/object-regexp-9.html
+% http://localhost/page_load_test/jss/object-regexp-90.html
+% http://localhost/page_load_test/jss/object-regexp-91.html
+% http://localhost/page_load_test/jss/object-regexp-92.html
+% http://localhost/page_load_test/jss/object-regexp-93.html
+% http://localhost/page_load_test/jss/object-regexp-94.html
+% http://localhost/page_load_test/jss/object-regexp-95.html
+% http://localhost/page_load_test/jss/object-regexp-96.html
+% http://localhost/page_load_test/jss/object-regexp-97.html
+% http://localhost/page_load_test/jss/object-regexp-98.html
+% http://localhost/page_load_test/jss/object-regexp-99.html
+% http://localhost/page_load_test/jss/object-string-1.html
+% http://localhost/page_load_test/jss/object-string-10.html
+% http://localhost/page_load_test/jss/object-string-11.html
+% http://localhost/page_load_test/jss/object-string-12.html
+% http://localhost/page_load_test/jss/object-string-13.html
+% http://localhost/page_load_test/jss/object-string-14.html
+% http://localhost/page_load_test/jss/object-string-15.html
+% http://localhost/page_load_test/jss/object-string-16.html
+% http://localhost/page_load_test/jss/object-string-17.html
+% http://localhost/page_load_test/jss/object-string-18.html
+% http://localhost/page_load_test/jss/object-string-19.html
+% http://localhost/page_load_test/jss/object-string-2.html
+% http://localhost/page_load_test/jss/object-string-20.html
+% http://localhost/page_load_test/jss/object-string-21.html
+% http://localhost/page_load_test/jss/object-string-22.html
+% http://localhost/page_load_test/jss/object-string-23.html
+% http://localhost/page_load_test/jss/object-string-24.html
+% http://localhost/page_load_test/jss/object-string-25.html
+% http://localhost/page_load_test/jss/object-string-26.html
+% http://localhost/page_load_test/jss/object-string-27.html
+% http://localhost/page_load_test/jss/object-string-28.html
+% http://localhost/page_load_test/jss/object-string-29.html
+% http://localhost/page_load_test/jss/object-string-3.html
+% http://localhost/page_load_test/jss/object-string-30.html
+% http://localhost/page_load_test/jss/object-string-31.html
+% http://localhost/page_load_test/jss/object-string-32.html
+% http://localhost/page_load_test/jss/object-string-33.html
+% http://localhost/page_load_test/jss/object-string-34.html
+% http://localhost/page_load_test/jss/object-string-35.html
+% http://localhost/page_load_test/jss/object-string-36.html
+% http://localhost/page_load_test/jss/object-string-37.html
+% http://localhost/page_load_test/jss/object-string-38.html
+% http://localhost/page_load_test/jss/object-string-39.html
+% http://localhost/page_load_test/jss/object-string-4.html
+% http://localhost/page_load_test/jss/object-string-40.html
+% http://localhost/page_load_test/jss/object-string-41.html
+% http://localhost/page_load_test/jss/object-string-42.html
+% http://localhost/page_load_test/jss/object-string-43.html
+% http://localhost/page_load_test/jss/object-string-44.html
+% http://localhost/page_load_test/jss/object-string-45.html
+% http://localhost/page_load_test/jss/object-string-46.html
+% http://localhost/page_load_test/jss/object-string-47.html
+% http://localhost/page_load_test/jss/object-string-48.html
+% http://localhost/page_load_test/jss/object-string-49.html
+% http://localhost/page_load_test/jss/object-string-5.html
+% http://localhost/page_load_test/jss/object-string-50.html
+% http://localhost/page_load_test/jss/object-string-51.html
+% http://localhost/page_load_test/jss/object-string-52.html
+% http://localhost/page_load_test/jss/object-string-53.html
+% http://localhost/page_load_test/jss/object-string-54.html
+% http://localhost/page_load_test/jss/object-string-55.html
+% http://localhost/page_load_test/jss/object-string-56.html
+% http://localhost/page_load_test/jss/object-string-57.html
+% http://localhost/page_load_test/jss/object-string-58.html
+% http://localhost/page_load_test/jss/object-string-59.html
+% http://localhost/page_load_test/jss/object-string-6.html
+% http://localhost/page_load_test/jss/object-string-60.html
+% http://localhost/page_load_test/jss/object-string-61.html
+% http://localhost/page_load_test/jss/object-string-62.html
+% http://localhost/page_load_test/jss/object-string-63.html
+% http://localhost/page_load_test/jss/object-string-64.html
+% http://localhost/page_load_test/jss/object-string-65.html
+% http://localhost/page_load_test/jss/object-string-66.html
+% http://localhost/page_load_test/jss/object-string-67.html
+% http://localhost/page_load_test/jss/object-string-68.html
+% http://localhost/page_load_test/jss/object-string-69.html
+% http://localhost/page_load_test/jss/object-string-7.html
+% http://localhost/page_load_test/jss/object-string-70.html
+% http://localhost/page_load_test/jss/object-string-71.html
+% http://localhost/page_load_test/jss/object-string-72.html
+% http://localhost/page_load_test/jss/object-string-73.html
+% http://localhost/page_load_test/jss/object-string-74.html
+% http://localhost/page_load_test/jss/object-string-75.html
+% http://localhost/page_load_test/jss/object-string-76.html
+% http://localhost/page_load_test/jss/object-string-77.html
+% http://localhost/page_load_test/jss/object-string-78.html
+% http://localhost/page_load_test/jss/object-string-79.html
+% http://localhost/page_load_test/jss/object-string-8.html
+% http://localhost/page_load_test/jss/object-string-80.html
+% http://localhost/page_load_test/jss/object-string-81.html
+% http://localhost/page_load_test/jss/object-string-82.html
+% http://localhost/page_load_test/jss/object-string-83.html
+% http://localhost/page_load_test/jss/object-string-84.html
+% http://localhost/page_load_test/jss/object-string-9.html
+% http://localhost/page_load_test/jss/real-base64-1.html
+% http://localhost/page_load_test/jss/real-base64-2.html
+% http://localhost/page_load_test/jss/real-base64-3.html
+% http://localhost/page_load_test/jss/real-base64-4.html
+% http://localhost/page_load_test/jss/real-base64-5.html
+% http://localhost/page_load_test/jss/real-base64-6.html
+% http://localhost/page_load_test/jss/real-base64-7.html
+% http://localhost/page_load_test/jss/real-base64-8.html
+% http://localhost/page_load_test/jss/real-binary-trees-1.html
+% http://localhost/page_load_test/jss/real-binary-trees-2.html
+% http://localhost/page_load_test/jss/real-binary-trees-3.html
+% http://localhost/page_load_test/jss/real-cube-1.html
+% http://localhost/page_load_test/jss/real-cube-2.html
+% http://localhost/page_load_test/jss/real-cube-3.html
+% http://localhost/page_load_test/jss/real-cube-4.html
+% http://localhost/page_load_test/jss/real-fannkuch-1.html
+% http://localhost/page_load_test/jss/real-fannkuch-2.html
+% http://localhost/page_load_test/jss/real-fannkuch-3.html
+% http://localhost/page_load_test/jss/real-fannkuch-4.html
+% http://localhost/page_load_test/jss/real-fasta-1.html
+% http://localhost/page_load_test/jss/real-fasta-10.html
+% http://localhost/page_load_test/jss/real-fasta-11.html
+% http://localhost/page_load_test/jss/real-fasta-12.html
+% http://localhost/page_load_test/jss/real-fasta-2.html
+% http://localhost/page_load_test/jss/real-fasta-3.html
+% http://localhost/page_load_test/jss/real-fasta-4.html
+% http://localhost/page_load_test/jss/real-fasta-5.html
+% http://localhost/page_load_test/jss/real-fasta-6.html
+% http://localhost/page_load_test/jss/real-fasta-7.html
+% http://localhost/page_load_test/jss/real-fasta-8.html
+% http://localhost/page_load_test/jss/real-fasta-9.html
+% http://localhost/page_load_test/jss/real-morph-1.html
+% http://localhost/page_load_test/jss/real-morph-2.html
+% http://localhost/page_load_test/jss/real-morph-3.html
+% http://localhost/page_load_test/jss/real-morph-4.html
+% http://localhost/page_load_test/jss/real-nbody-1.html
+% http://localhost/page_load_test/jss/real-nbody-2.html
+% http://localhost/page_load_test/jss/real-nbody-3.html
+% http://localhost/page_load_test/jss/real-nbody-4.html
+% http://localhost/page_load_test/jss/real-nsieve-1.html
+% http://localhost/page_load_test/jss/real-nsieve-2.html
+% http://localhost/page_load_test/jss/real-nsieve-3.html
+% http://localhost/page_load_test/jss/real-nsieve-4.html
+% http://localhost/page_load_test/jss/real-nsieve-bits-1.html
+% http://localhost/page_load_test/jss/real-nsieve-bits-2.html
+% http://localhost/page_load_test/jss/real-nsieve-bits-3.html
+% http://localhost/page_load_test/jss/real-nsieve-bits-4.html
+% http://localhost/page_load_test/jss/real-packer-1.html
+% http://localhost/page_load_test/jss/real-packer-2.html
+% http://localhost/page_load_test/jss/real-packer-3.html
+% http://localhost/page_load_test/jss/real-packer-4.html
+% http://localhost/page_load_test/jss/real-packer-5.html
+% http://localhost/page_load_test/jss/real-partial-sums-1.html
+% http://localhost/page_load_test/jss/real-partial-sums-2.html
+% http://localhost/page_load_test/jss/real-partial-sums-3.html
+% http://localhost/page_load_test/jss/real-partial-sums-4.html
+% http://localhost/page_load_test/jss/real-recursive-1.html
+% http://localhost/page_load_test/jss/real-recursive-10.html
+% http://localhost/page_load_test/jss/real-recursive-11.html
+% http://localhost/page_load_test/jss/real-recursive-12.html
+% http://localhost/page_load_test/jss/real-recursive-2.html
+% http://localhost/page_load_test/jss/real-recursive-3.html
+% http://localhost/page_load_test/jss/real-recursive-4.html
+% http://localhost/page_load_test/jss/real-recursive-5.html
+% http://localhost/page_load_test/jss/real-recursive-6.html
+% http://localhost/page_load_test/jss/real-recursive-7.html
+% http://localhost/page_load_test/jss/real-recursive-8.html
+% http://localhost/page_load_test/jss/real-recursive-9.html
+% http://localhost/page_load_test/jss/real-spectral-norm-1.html
+% http://localhost/page_load_test/jss/real-spectral-norm-2.html
+% http://localhost/page_load_test/jss/real-spectral-norm-3.html
+% http://localhost/page_load_test/jss/real-spectral-norm-4.html
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-1.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-1.html
new file mode 100644
index 00000000000..a6a79493104
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-1.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, []', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-10.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-10.html
new file mode 100644
index 00000000000..ad94336b5c3
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-10.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, new Array()', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-11.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-11.html
new file mode 100644
index 00000000000..10722337f47
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-11.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, push', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-12.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-12.html
new file mode 100644
index 00000000000..343d7812540
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-12.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, pop', onlyNum = 256;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-13.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-13.html
new file mode 100644
index 00000000000..f1823356fff
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-13.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, unshift', onlyNum = 256;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-14.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-14.html
new file mode 100644
index 00000000000..7248c694f89
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-14.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, shift', onlyNum = 256;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-15.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-15.html
new file mode 100644
index 00000000000..9db8b9bda57
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-15.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, splice', onlyNum = 256;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-16.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-16.html
new file mode 100644
index 00000000000..10a0490f244
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-16.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, splice', onlyNum = 256;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-17.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-17.html
new file mode 100644
index 00000000000..67b0882822a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-17.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, []', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-18.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-18.html
new file mode 100644
index 00000000000..56a90aebe5e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-18.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, new Array()', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-19.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-19.html
new file mode 100644
index 00000000000..4d7423754f3
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-19.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, push', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-2.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-2.html
new file mode 100644
index 00000000000..bd181eb6a7a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-2.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, new Array()', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-20.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-20.html
new file mode 100644
index 00000000000..f0650e03033
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-20.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, pop', onlyNum = 512;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-21.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-21.html
new file mode 100644
index 00000000000..944ce2d2574
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-21.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, unshift', onlyNum = 512;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-22.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-22.html
new file mode 100644
index 00000000000..6adcad3fe25
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-22.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, shift', onlyNum = 512;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-23.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-23.html
new file mode 100644
index 00000000000..36f9113d076
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-23.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, splice', onlyNum = 512;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-24.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-24.html
new file mode 100644
index 00000000000..19ae8bf4e03
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-24.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, splice', onlyNum = 512;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-25.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-25.html
new file mode 100644
index 00000000000..f8f429dfdad
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-25.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, []', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-26.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-26.html
new file mode 100644
index 00000000000..17813434892
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-26.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, new Array()', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-27.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-27.html
new file mode 100644
index 00000000000..5820fcd649f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-27.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, push', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-28.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-28.html
new file mode 100644
index 00000000000..5964c76574c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-28.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, pop', onlyNum = 1024;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-29.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-29.html
new file mode 100644
index 00000000000..32d5de69bae
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-29.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, unshift', onlyNum = 1024;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-3.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-3.html
new file mode 100644
index 00000000000..226be223ddb
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-3.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, push', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-30.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-30.html
new file mode 100644
index 00000000000..b30ffad5510
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-30.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, shift', onlyNum = 1024;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-31.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-31.html
new file mode 100644
index 00000000000..1cd7b990446
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-31.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, splice', onlyNum = 1024;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-32.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-32.html
new file mode 100644
index 00000000000..02f49b3db5c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-32.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, splice', onlyNum = 1024;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-4.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-4.html
new file mode 100644
index 00000000000..3ce4b31cc39
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-4.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, pop', onlyNum = 128;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-5.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-5.html
new file mode 100644
index 00000000000..6699f7fb98e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-5.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, unshift', onlyNum = 128;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-6.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-6.html
new file mode 100644
index 00000000000..3ac5c5d6f0e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-6.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, shift', onlyNum = 128;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-7.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-7.html
new file mode 100644
index 00000000000..6ca19592b25
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-7.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, splice', onlyNum = 128;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-8.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-8.html
new file mode 100644
index 00000000000..fb890c01288
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-8.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Deconstruction, splice', onlyNum = 128;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-array-9.html b/mozilla/testing/performance/talos/page_load_test/jss/object-array-9.html
new file mode 100644
index 00000000000..00ba5195eef
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-array-9.html
@@ -0,0 +1,68 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array Construction, []', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-array");
+
+var ret = [], tmp, num = 500;
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: Array Building
+
+	test("Array Construction, []", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = [];
+			ret.length = i;
+		}
+	});
+
+	test("Array Construction, new Array()", i, function(){
+		for ( var j = 0; j < num; j++ )
+			ret = new Array(i);
+	});
+
+	test("Array Construction, push", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.push(j);
+	});
+
+	i /= 128;
+
+	test("Array Deconstruction, pop", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.pop();
+	});
+
+	test("Array Construction, unshift", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.unshift(j);
+	});
+
+	test("Array Deconstruction, shift", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.shift();
+	});
+
+	test("Array Construction, splice", i, function(){
+		ret = [];
+		for ( var j = 0; j < i; j++ )
+			ret.splice(0,0,j);
+	});
+
+	test("Array Deconstruction, splice", i, function(){
+		for ( var j = 0; j < i; j++ )
+			tmp = ret.splice(0,1);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-1.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-1.html
new file mode 100644
index 00000000000..369db67530c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-1.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Empty Split', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-10.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-10.html
new file mode 100644
index 00000000000..255a887a549
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-10.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Empty Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-100.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-100.html
new file mode 100644
index 00000000000..1a6141c69d2
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-100.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Match', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-101.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-101.html
new file mode 100644
index 00000000000..5f17cc58539
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-101.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Test', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-102.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-102.html
new file mode 100644
index 00000000000..49035c2ec3b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-102.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Empty Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-103.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-103.html
new file mode 100644
index 00000000000..2171e338d0d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-103.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled 12 Char Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-104.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-104.html
new file mode 100644
index 00000000000..55b6d042ba7
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-104.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Match', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-105.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-105.html
new file mode 100644
index 00000000000..868ab51455c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-105.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Test', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-106.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-106.html
new file mode 100644
index 00000000000..f0ee75a2fc0
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-106.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Empty Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-107.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-107.html
new file mode 100644
index 00000000000..1eeeba46d21
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-107.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object 12 Char Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-108.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-108.html
new file mode 100644
index 00000000000..a98856f8b81
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-108.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object 12 Char Replace Function', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-109.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-109.html
new file mode 100644
index 00000000000..ad7d323154b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-109.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Match', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-11.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-11.html
new file mode 100644
index 00000000000..bf4c6389867
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-11.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object 12 Char Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-110.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-110.html
new file mode 100644
index 00000000000..46125a97021
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-110.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Test', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-111.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-111.html
new file mode 100644
index 00000000000..c1581114209
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-111.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Empty Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-112.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-112.html
new file mode 100644
index 00000000000..cb11b883598
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-112.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable 12 Char Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-113.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-113.html
new file mode 100644
index 00000000000..337e1a29d27
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-113.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Match', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-114.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-114.html
new file mode 100644
index 00000000000..809f914d610
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-114.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Test', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-115.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-115.html
new file mode 100644
index 00000000000..65eb40eec0f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-115.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Empty Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-116.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-116.html
new file mode 100644
index 00000000000..0e191ea7e3a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-116.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object 12 Char Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-117.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-117.html
new file mode 100644
index 00000000000..630034b33ec
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-117.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object 12 Char Replace Function', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-118.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-118.html
new file mode 100644
index 00000000000..739d556219a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-118.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Match', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-119.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-119.html
new file mode 100644
index 00000000000..b1329b54575
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-119.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-12.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-12.html
new file mode 100644
index 00000000000..099bea44108
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-12.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object 12 Char Replace Function', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-120.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-120.html
new file mode 100644
index 00000000000..7197beef7e8
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-120.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Capture', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-121.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-121.html
new file mode 100644
index 00000000000..1c059b6b742
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-121.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Capture Function', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-122.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-122.html
new file mode 100644
index 00000000000..63ab0441adf
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-122.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Upperase Capture Function', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-123.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-123.html
new file mode 100644
index 00000000000..41841200ddd
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-123.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Match', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-124.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-124.html
new file mode 100644
index 00000000000..035278365d0
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-124.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Test', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-125.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-125.html
new file mode 100644
index 00000000000..b08f5767a53
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-125.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Empty Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-126.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-126.html
new file mode 100644
index 00000000000..56b1bf6cf1a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-126.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled 12 Char Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-127.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-127.html
new file mode 100644
index 00000000000..f4773453d87
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-127.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Match', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-128.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-128.html
new file mode 100644
index 00000000000..6b7299ac8bc
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-128.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Test', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-129.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-129.html
new file mode 100644
index 00000000000..cb789404cc2
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-129.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Empty Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-13.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-13.html
new file mode 100644
index 00000000000..8fa51b8eb95
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-13.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Match', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-130.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-130.html
new file mode 100644
index 00000000000..fa2e4003837
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-130.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object 12 Char Replace', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-14.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-14.html
new file mode 100644
index 00000000000..40e1c876bb5
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-14.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Test', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-15.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-15.html
new file mode 100644
index 00000000000..fba3496ceea
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-15.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Empty Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-16.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-16.html
new file mode 100644
index 00000000000..2bac1a382f7
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-16.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable 12 Char Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-17.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-17.html
new file mode 100644
index 00000000000..d6af52ae87f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-17.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Match', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-18.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-18.html
new file mode 100644
index 00000000000..923378d61a5
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-18.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Test', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-19.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-19.html
new file mode 100644
index 00000000000..4e7c4326b29
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-19.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Empty Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-2.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-2.html
new file mode 100644
index 00000000000..8325f5bf9ed
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-2.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Char Split', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-20.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-20.html
new file mode 100644
index 00000000000..689b1216903
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-20.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object 12 Char Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-21.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-21.html
new file mode 100644
index 00000000000..d24085ac84e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-21.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object 12 Char Replace Function', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-22.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-22.html
new file mode 100644
index 00000000000..9bcd178e716
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-22.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Match', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-23.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-23.html
new file mode 100644
index 00000000000..64698f8fed2
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-23.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-24.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-24.html
new file mode 100644
index 00000000000..44cf783afb2
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-24.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Capture', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-25.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-25.html
new file mode 100644
index 00000000000..ca17c526291
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-25.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Capture Function', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-26.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-26.html
new file mode 100644
index 00000000000..bef87dfc1a9
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-26.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Upperase Capture Function', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-27.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-27.html
new file mode 100644
index 00000000000..a2fb53e2509
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-27.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Match', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-28.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-28.html
new file mode 100644
index 00000000000..85c3f24d8e2
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-28.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Test', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-29.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-29.html
new file mode 100644
index 00000000000..5d71d41c2b5
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-29.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Empty Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-3.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-3.html
new file mode 100644
index 00000000000..6a79bf69bb9
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-3.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Variable Split', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-30.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-30.html
new file mode 100644
index 00000000000..44d1c6089e1
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-30.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled 12 Char Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-31.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-31.html
new file mode 100644
index 00000000000..f1964bd579d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-31.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Match', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-32.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-32.html
new file mode 100644
index 00000000000..60fa9d47e64
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-32.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Test', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-33.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-33.html
new file mode 100644
index 00000000000..737940b4314
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-33.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Empty Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-34.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-34.html
new file mode 100644
index 00000000000..4eca6d7e26e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-34.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object 12 Char Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-35.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-35.html
new file mode 100644
index 00000000000..bae7e6ce147
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-35.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Empty Split', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-36.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-36.html
new file mode 100644
index 00000000000..be811e8419c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-36.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Char Split', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-37.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-37.html
new file mode 100644
index 00000000000..b17484924fe
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-37.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Variable Split', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-38.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-38.html
new file mode 100644
index 00000000000..c42d8f098b6
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-38.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Match', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-39.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-39.html
new file mode 100644
index 00000000000..6ba84f4214f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-39.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Test', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-4.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-4.html
new file mode 100644
index 00000000000..792b5ad11ab
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-4.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Match', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-40.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-40.html
new file mode 100644
index 00000000000..8f5bdd48a46
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-40.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Empty Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-41.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-41.html
new file mode 100644
index 00000000000..b7efa7df10d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-41.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled 12 Char Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-42.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-42.html
new file mode 100644
index 00000000000..8e37999b073
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-42.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Match', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-43.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-43.html
new file mode 100644
index 00000000000..02cadc3450b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-43.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Test', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-44.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-44.html
new file mode 100644
index 00000000000..e278207859c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-44.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Empty Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-45.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-45.html
new file mode 100644
index 00000000000..4137b8d180c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-45.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object 12 Char Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-46.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-46.html
new file mode 100644
index 00000000000..70868e67861
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-46.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object 12 Char Replace Function', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-47.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-47.html
new file mode 100644
index 00000000000..ed043fe2a1d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-47.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Match', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-48.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-48.html
new file mode 100644
index 00000000000..c4d63632749
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-48.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Test', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-49.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-49.html
new file mode 100644
index 00000000000..9875ba862bc
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-49.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Empty Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-5.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-5.html
new file mode 100644
index 00000000000..8d9f0f80f82
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-5.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Test', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-50.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-50.html
new file mode 100644
index 00000000000..deeada1612a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-50.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable 12 Char Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-51.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-51.html
new file mode 100644
index 00000000000..d962167a1c8
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-51.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Match', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-52.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-52.html
new file mode 100644
index 00000000000..74a4779b23b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-52.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Test', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-53.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-53.html
new file mode 100644
index 00000000000..a2868fccdeb
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-53.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Empty Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-54.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-54.html
new file mode 100644
index 00000000000..3cd61f0f40b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-54.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object 12 Char Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-55.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-55.html
new file mode 100644
index 00000000000..a8f2c627c7f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-55.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object 12 Char Replace Function', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-56.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-56.html
new file mode 100644
index 00000000000..01559a07fdb
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-56.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Match', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-57.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-57.html
new file mode 100644
index 00000000000..c9d4e050dad
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-57.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-58.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-58.html
new file mode 100644
index 00000000000..4a677251a06
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-58.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Capture', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-59.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-59.html
new file mode 100644
index 00000000000..083d6ac0612
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-59.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Capture Function', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-6.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-6.html
new file mode 100644
index 00000000000..9aab9083207
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-6.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Empty Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-60.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-60.html
new file mode 100644
index 00000000000..402d4bff1e0
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-60.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Upperase Capture Function', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-61.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-61.html
new file mode 100644
index 00000000000..cf6d6765fb0
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-61.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Match', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-62.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-62.html
new file mode 100644
index 00000000000..23077a733de
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-62.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Test', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-63.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-63.html
new file mode 100644
index 00000000000..de9dcc946a8
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-63.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Empty Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-64.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-64.html
new file mode 100644
index 00000000000..2b25a33b23e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-64.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled 12 Char Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-65.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-65.html
new file mode 100644
index 00000000000..bdbe9f43775
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-65.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Match', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-66.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-66.html
new file mode 100644
index 00000000000..871481f5a0f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-66.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Test', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-67.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-67.html
new file mode 100644
index 00000000000..8082daac592
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-67.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Empty Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-68.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-68.html
new file mode 100644
index 00000000000..52544505713
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-68.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object 12 Char Replace', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-69.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-69.html
new file mode 100644
index 00000000000..47b7aaa3b6f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-69.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Match', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-7.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-7.html
new file mode 100644
index 00000000000..28089c178ae
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-7.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled 12 Char Replace', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-70.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-70.html
new file mode 100644
index 00000000000..2384f3205b0
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-70.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Test', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-71.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-71.html
new file mode 100644
index 00000000000..b973ceb6f6d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-71.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Empty Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-72.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-72.html
new file mode 100644
index 00000000000..5aaf44d8f17
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-72.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled 12 Char Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-73.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-73.html
new file mode 100644
index 00000000000..18603d978a5
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-73.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Match', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-74.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-74.html
new file mode 100644
index 00000000000..58b8838f6d3
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-74.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Test', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-75.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-75.html
new file mode 100644
index 00000000000..cf9bbc30cdc
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-75.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Empty Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-76.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-76.html
new file mode 100644
index 00000000000..62ab6fa4297
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-76.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object 12 Char Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-77.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-77.html
new file mode 100644
index 00000000000..cdebd3d698b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-77.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object 12 Char Replace Function', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-78.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-78.html
new file mode 100644
index 00000000000..e3cc06f090e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-78.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Match', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-79.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-79.html
new file mode 100644
index 00000000000..a89f9a7659b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-79.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Test', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-8.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-8.html
new file mode 100644
index 00000000000..0c4bdc55d46
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-8.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Match', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-80.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-80.html
new file mode 100644
index 00000000000..88064d6d605
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-80.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Empty Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-81.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-81.html
new file mode 100644
index 00000000000..06be61381e4
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-81.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable 12 Char Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-82.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-82.html
new file mode 100644
index 00000000000..3eb2bac3a1d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-82.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Match', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-83.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-83.html
new file mode 100644
index 00000000000..e44ae10971b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-83.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Test', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-84.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-84.html
new file mode 100644
index 00000000000..76ec6c1fdba
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-84.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object Empty Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-85.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-85.html
new file mode 100644
index 00000000000..0bba3017554
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-85.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object 12 Char Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-86.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-86.html
new file mode 100644
index 00000000000..9f8adb06235
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-86.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Variable Object 12 Char Replace Function', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-87.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-87.html
new file mode 100644
index 00000000000..07cb4d337cf
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-87.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Match', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-88.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-88.html
new file mode 100644
index 00000000000..d61e5362e72
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-88.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-89.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-89.html
new file mode 100644
index 00000000000..44da564fea4
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-89.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Capture', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-9.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-9.html
new file mode 100644
index 00000000000..11fbd9b9043
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-9.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Object Test', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-90.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-90.html
new file mode 100644
index 00000000000..e63c8881077
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-90.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Capture Function', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-91.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-91.html
new file mode 100644
index 00000000000..f6f437b833f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-91.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Compiled Capture Replace with Upperase Capture Function', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-92.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-92.html
new file mode 100644
index 00000000000..4bc05c884ad
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-92.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Match', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-93.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-93.html
new file mode 100644
index 00000000000..877c48a5bf9
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-93.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Test', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-94.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-94.html
new file mode 100644
index 00000000000..f25513e4c7e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-94.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Empty Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-95.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-95.html
new file mode 100644
index 00000000000..53a5e610db5
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-95.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled 12 Char Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-96.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-96.html
new file mode 100644
index 00000000000..4433156a418
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-96.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Match', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-97.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-97.html
new file mode 100644
index 00000000000..a12a692988e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-97.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Test', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-98.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-98.html
new file mode 100644
index 00000000000..3ce82fd92c0
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-98.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object Empty Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-99.html b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-99.html
new file mode 100644
index 00000000000..49528ebb070
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-regexp-99.html
@@ -0,0 +1,264 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Uncompiled Object 12 Char Replace', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-regexp");
+
+// Try to force real results
+var str = "", tmp, ret, re;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+	// Note: These tests are really slow, so we're running them for smaller
+	//       test sets only.
+
+	if ( i <= 32768 ) {
+		re = //;
+		tmp = str;
+
+		test( "Compiled Object Empty Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /a/;
+		tmp = str;
+
+		test( "Compiled Object Char Split", i, function(){
+			ret = tmp.split( re );
+		});
+
+		re = /.*/;
+		tmp = str;
+
+		test( "Compiled Object Variable Split", i, function(){
+			ret = tmp.split( re );
+		});
+	}
+    
+	// TESTS: Compiled RegExps
+    
+	re = /aaaaaaaaaa/g;
+    
+	tmp = str;
+    
+	test( "Compiled Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Variable Length
+	
+	re = /a.*a/;
+	
+	tmp = str;
+    
+	test( "Compiled Variable Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	re = new RegExp("aaaaaaaaaa", "g");
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+    
+	test( "Compiled Variable Object Test", i, function(){
+		ret = re.test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Compiled Variable Object Empty Replace", i, function(){
+		ret = tmp.replace( re, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Variable Object 12 Char Replace Function", i, function(){
+		ret = tmp.replace( re, function(all){
+			return "asdfasdfasdf";
+		});
+	});
+	
+	// TESTS: Capturing
+	
+	re = /aa(b)aa/g;
+	
+	tmp = str;
+	
+	test( "Compiled Capture Match", i, function(){
+		ret = tmp.match( re );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace", i, function(){
+		ret = tmp.replace( re, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture", i, function(){
+		ret = tmp.replace( re, "asdf\\1asdfasdf" );
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return "asdf" + capture + "asdfasdf";
+		});
+	});
+	
+	tmp = str;
+	
+	test( "Compiled Capture Replace with Upperase Capture Function", i, function(){
+		ret = tmp.replace( re, function(all,capture){
+			return capture.toUpperCase();
+		});
+	});
+	
+	// TESTS: Uncompiled RegExps
+	
+	tmp = str;
+    
+	test( "Uncompiled Match", i, function(){
+		ret = tmp.match( /aaaaaaaaaa/g );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Test", i, function(){
+		ret = (/aaaaaaaaaa/g).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Empty Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled 12 Char Replace", i, function(){
+		ret = tmp.replace( /aaaaaaaaaa/g, "asdfasdfasdf" );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Match", i, function(){
+		ret = tmp.match( new RegExp("aaaaaaaaaa", "g") );
+	});
+	
+	tmp = str;
+    
+	test( "Uncompiled Object Test", i, function(){
+		ret = (new RegExp("aaaaaaaaaa", "g")).test( tmp );
+	});
+    
+	tmp = str;
+    
+	test( "Uncompiled Object Empty Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "" );
+	});
+	
+	tmp = str;
+	
+	test( "Uncompiled Object 12 Char Replace", i, function(){
+		ret = tmp.replace( new RegExp("aaaaaaaaaa", "g"), "asdfasdfasdf" );
+	});
+	
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-1.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-1.html
new file mode 100644
index 00000000000..605a551609f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-1.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String', onlyNum = 500;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-10.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-10.html
new file mode 100644
index 00000000000..3cdae9f3561
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-10.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String Object', onlyNum = 2000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-11.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-11.html
new file mode 100644
index 00000000000..1c9e56a5ef6
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-11.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String from charCode', onlyNum = 2000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-12.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-12.html
new file mode 100644
index 00000000000..1983531e455
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-12.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array String Join', onlyNum = 2000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-13.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-13.html
new file mode 100644
index 00000000000..b2d0ef45ec9
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-13.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String', onlyNum = 4000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-14.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-14.html
new file mode 100644
index 00000000000..5cea33c67ff
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-14.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String Object', onlyNum = 4000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-15.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-15.html
new file mode 100644
index 00000000000..12fd17cccff
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-15.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String from charCode', onlyNum = 4000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-16.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-16.html
new file mode 100644
index 00000000000..bbfe63269ca
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-16.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array String Join', onlyNum = 4000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-17.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-17.html
new file mode 100644
index 00000000000..ad9ec78ed06
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-17.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'String Split', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-18.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-18.html
new file mode 100644
index 00000000000..c2aa9926c23
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-18.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'String Split on Char', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-19.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-19.html
new file mode 100644
index 00000000000..bec074ca4eb
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-19.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'charAt', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-2.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-2.html
new file mode 100644
index 00000000000..9171c62fcc6
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-2.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String Object', onlyNum = 500;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-20.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-20.html
new file mode 100644
index 00000000000..764dc394fe6
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-20.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = '[Number]', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-21.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-21.html
new file mode 100644
index 00000000000..2c1ff165c20
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-21.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'charCodeAt', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-22.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-22.html
new file mode 100644
index 00000000000..0d26d3e390a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-22.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'indexOf', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-23.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-23.html
new file mode 100644
index 00000000000..f643887c260
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-23.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'lastIndexOf', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-24.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-24.html
new file mode 100644
index 00000000000..be52dd68ff5
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-24.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'length', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-25.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-25.html
new file mode 100644
index 00000000000..fa539600d51
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-25.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'slice', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-26.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-26.html
new file mode 100644
index 00000000000..6d872da300f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-26.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'substr', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-27.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-27.html
new file mode 100644
index 00000000000..cec72bc44e8
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-27.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'substring', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-28.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-28.html
new file mode 100644
index 00000000000..d5e2e55b743
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-28.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toLowerCase', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-29.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-29.html
new file mode 100644
index 00000000000..57308e6c8d8
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-29.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toUpperCase', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-3.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-3.html
new file mode 100644
index 00000000000..02d2f13fc49
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-3.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String from charCode', onlyNum = 500;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-30.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-30.html
new file mode 100644
index 00000000000..f5003c9b0c0
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-30.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toSource', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-31.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-31.html
new file mode 100644
index 00000000000..c5a4f30f295
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-31.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toString', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-32.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-32.html
new file mode 100644
index 00000000000..49ab56fe0b4
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-32.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'valueOf', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-33.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-33.html
new file mode 100644
index 00000000000..864bb48f214
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-33.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'comparing', onlyNum = 16384;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-34.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-34.html
new file mode 100644
index 00000000000..4dbab684b9c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-34.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'String Split', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-35.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-35.html
new file mode 100644
index 00000000000..4609c7c382f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-35.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'String Split on Char', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-36.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-36.html
new file mode 100644
index 00000000000..d430ff539f4
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-36.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'charAt', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-37.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-37.html
new file mode 100644
index 00000000000..e40ac1f3cf8
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-37.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = '[Number]', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-38.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-38.html
new file mode 100644
index 00000000000..c212a543b14
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-38.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'charCodeAt', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-39.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-39.html
new file mode 100644
index 00000000000..9a53d730455
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-39.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'indexOf', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-4.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-4.html
new file mode 100644
index 00000000000..d6caf674383
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-4.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array String Join', onlyNum = 500;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-40.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-40.html
new file mode 100644
index 00000000000..de8f850245f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-40.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'lastIndexOf', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-41.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-41.html
new file mode 100644
index 00000000000..69b31151bee
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-41.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'length', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-42.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-42.html
new file mode 100644
index 00000000000..1310820e5d5
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-42.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'slice', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-43.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-43.html
new file mode 100644
index 00000000000..076ca358fd1
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-43.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'substr', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-44.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-44.html
new file mode 100644
index 00000000000..dc8534953f1
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-44.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'substring', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-45.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-45.html
new file mode 100644
index 00000000000..0224f815ba3
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-45.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toLowerCase', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-46.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-46.html
new file mode 100644
index 00000000000..a3d6172b39f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-46.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toUpperCase', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-47.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-47.html
new file mode 100644
index 00000000000..750a5a705ae
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-47.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toSource', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-48.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-48.html
new file mode 100644
index 00000000000..4d2baba22dc
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-48.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toString', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-49.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-49.html
new file mode 100644
index 00000000000..86523648105
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-49.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'valueOf', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-5.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-5.html
new file mode 100644
index 00000000000..3b2f02f5963
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-5.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String', onlyNum = 1000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-50.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-50.html
new file mode 100644
index 00000000000..d562b14d17b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-50.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'comparing', onlyNum = 32768;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-51.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-51.html
new file mode 100644
index 00000000000..3cdf314b09d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-51.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'String Split', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-52.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-52.html
new file mode 100644
index 00000000000..a3cb4df55ab
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-52.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'String Split on Char', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-53.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-53.html
new file mode 100644
index 00000000000..1d67f8dd47d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-53.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'charAt', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-54.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-54.html
new file mode 100644
index 00000000000..274d035c729
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-54.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = '[Number]', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-55.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-55.html
new file mode 100644
index 00000000000..3b015e5d39c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-55.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'charCodeAt', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-56.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-56.html
new file mode 100644
index 00000000000..730a274ff62
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-56.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'indexOf', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-57.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-57.html
new file mode 100644
index 00000000000..9198a5eba76
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-57.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'lastIndexOf', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-58.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-58.html
new file mode 100644
index 00000000000..bdf951713a0
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-58.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'length', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-59.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-59.html
new file mode 100644
index 00000000000..b2f7c0e1cc6
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-59.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'slice', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-6.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-6.html
new file mode 100644
index 00000000000..e707decd585
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-6.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String Object', onlyNum = 1000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-60.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-60.html
new file mode 100644
index 00000000000..955cc8b5fff
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-60.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'substr', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-61.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-61.html
new file mode 100644
index 00000000000..329d1ead217
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-61.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'substring', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-62.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-62.html
new file mode 100644
index 00000000000..5b8d32dadbe
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-62.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toLowerCase', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-63.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-63.html
new file mode 100644
index 00000000000..9740cc1e87c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-63.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toUpperCase', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-64.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-64.html
new file mode 100644
index 00000000000..1021ee21f9e
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-64.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toSource', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-65.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-65.html
new file mode 100644
index 00000000000..0768409d513
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-65.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toString', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-66.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-66.html
new file mode 100644
index 00000000000..d4bfb5b5ef2
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-66.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'valueOf', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-67.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-67.html
new file mode 100644
index 00000000000..8c594d2bf6a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-67.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'comparing', onlyNum = 65536;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-68.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-68.html
new file mode 100644
index 00000000000..6b154816b9b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-68.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'String Split', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-69.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-69.html
new file mode 100644
index 00000000000..b6f197f02fe
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-69.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'String Split on Char', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-7.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-7.html
new file mode 100644
index 00000000000..2e925ba5271
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-7.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String from charCode', onlyNum = 1000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-70.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-70.html
new file mode 100644
index 00000000000..f6d726f6f74
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-70.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'charAt', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-71.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-71.html
new file mode 100644
index 00000000000..dbe0528840b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-71.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = '[Number]', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-72.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-72.html
new file mode 100644
index 00000000000..4a6a8eeda8b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-72.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'charCodeAt', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-73.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-73.html
new file mode 100644
index 00000000000..4beee5b25e4
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-73.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'indexOf', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-74.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-74.html
new file mode 100644
index 00000000000..984d4bad516
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-74.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'lastIndexOf', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-75.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-75.html
new file mode 100644
index 00000000000..9b891e76b1d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-75.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'length', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-76.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-76.html
new file mode 100644
index 00000000000..0f12f61521c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-76.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'slice', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-77.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-77.html
new file mode 100644
index 00000000000..083946a0d19
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-77.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'substr', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-78.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-78.html
new file mode 100644
index 00000000000..e6889ddf32b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-78.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'substring', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-79.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-79.html
new file mode 100644
index 00000000000..d592db5790c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-79.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toLowerCase', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-8.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-8.html
new file mode 100644
index 00000000000..ee4f72e7fdb
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-8.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Array String Join', onlyNum = 1000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-80.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-80.html
new file mode 100644
index 00000000000..e24d658b6ef
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-80.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toUpperCase', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-81.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-81.html
new file mode 100644
index 00000000000..26184ba3cc7
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-81.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toSource', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-82.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-82.html
new file mode 100644
index 00000000000..1de01676ef5
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-82.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'toString', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-83.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-83.html
new file mode 100644
index 00000000000..10b1a090f1d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-83.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'valueOf', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-84.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-84.html
new file mode 100644
index 00000000000..a96aafc6875
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-84.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'comparing', onlyNum = 131072;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/object-string-9.html b/mozilla/testing/performance/talos/page_load_test/jss/object-string-9.html
new file mode 100644
index 00000000000..26d278bfc77
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/object-string-9.html
@@ -0,0 +1,222 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Concat String', onlyNum = 2000;
+function thisTest() {
+
+startTest("object-string");
+
+// Try to force real results
+var ret;
+
+// TESTS: String concatenation
+
+for ( var num = 500; num <= 4000; num *= 2 ) (function(num){
+
+	test( "Concat String", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String Object", num, function(){
+		var str = new String();
+		for ( var i = 0; i < num; i++ )
+			str += "a";
+		ret = str;
+	});
+
+	test( "Concat String from charCode", num, function(){
+		var str = "";
+		for ( var i = 0; i < num; i++ )
+			str += String.fromCharCode(97);
+		ret = str;
+	});
+
+	test( "Array String Join", num, function(){
+		var str = [];
+		for ( var i = 0; i < num; i++ )
+			str.push("a");
+		ret = str.join("");
+	});
+
+})(num);
+
+var str = "", tmp, num = 50;
+
+for ( var i = 0; i < 16384; i++ )
+	str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 16384; i <= 131072; i *= 2 ) (function(i){
+
+	// TESTS: split
+
+	test( "String Split", i, function(){
+		ret = str.split("");
+	});
+
+	test( "String Split on Char", i, function(){
+		ret = str.split("a");
+	});
+
+	// TESTS: characters
+
+	test( "charAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charAt(0);
+			ret = str.charAt(str.length - 1);
+			ret = str.charAt( 15000 );
+			ret = str.charAt( 12000 );
+		}
+	});
+
+	test( "[Number]", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str[0];
+			ret = str[str.length - 1];
+			ret = str[ 15000 ];
+			ret = str[ 12000 ];
+		}
+	});
+
+	test( "charCodeAt", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.charCodeAt(0);
+			ret = str.charCodeAt(str.length - 1);
+			ret = str.charCodeAt( 15000 );
+			ret = str.charCodeAt( 12000 );
+		}
+	});
+
+	// TESTS: indexOf
+
+	test( "indexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.indexOf("a");
+			ret = str.indexOf("b");
+			ret = str.indexOf("c");
+			ret = str.indexOf("d");
+		}
+	});
+
+	test( "lastIndexOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.lastIndexOf("a");
+			ret = str.lastIndexOf("b");
+			ret = str.lastIndexOf("c");
+			ret = str.lastIndexOf("d");
+		}
+	});
+
+	// TESTS: length
+
+	test( "length", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+			ret = str.length;
+		}
+	});
+
+	// TESTS: slice
+
+	test( "slice", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.slice(0);
+			ret = str.slice(0,5);
+			ret = str.slice(-1);
+			ret = str.slice(-6,-1);
+			ret = str.slice( 15000, 15005 );
+			ret = str.slice( 12000, -1 );
+		}
+	});
+
+	// TESTS: substr
+
+	test( "substr", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substr(0);
+			ret = str.substr(0,5);
+			ret = str.substr(-1);
+			ret = str.substr(-6,1);
+			ret = str.substr( 15000, 5 );
+			ret = str.substr( 12000, 5 );
+		}
+	});
+
+	// TESTS: substring
+
+	test( "substring", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.substring(0);
+			ret = str.substring(0,5);
+			ret = str.substring(-1);
+			ret = str.substring(-6,-1);
+			ret = str.substring( 15000, 15005 );
+			ret = str.substring( 12000, -1 );
+		}
+	});
+
+	// TESTS: toLower/UpperCase
+
+	test( "toLowerCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toLowerCase();
+		}
+	});
+
+	test( "toUpperCase", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toUpperCase();
+		}
+	});
+
+	// TESTS: toSource
+
+	test( "toSource", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toSource();
+		}
+	});
+
+	// TESTS: toString
+
+	test( "toString", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.toString();
+		}
+	});
+
+	// TESTS: valueOf
+
+	test( "valueOf", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str.valueOf();
+		}
+	});
+
+	// TESTS: comparing
+
+	var tmp = str + "a";
+
+	test( "comparing", i, function(){
+		for ( var j = 0; j < num; j++ ) {
+			ret = str == tmp;
+			ret = str < tmp;
+			ret = str > tmp;
+		}
+	});
+
+	// Double the length of the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-base64-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-1.html
new file mode 100644
index 00000000000..a76cb1d013c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-1.html
@@ -0,0 +1,155 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Convert String to Base 64', onlyNum = 2048;
+function thisTest() {
+
+/* ***** BEGIN LICENSE BLOCK *****
+ * Version: MPL 1.1/GPL 2.0/LGPL 2.1
+ *
+ * The contents of this file are subject to the Mozilla Public License Version
+ * 1.1 (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ * http://www.mozilla.org/MPL/
+ *
+ * Software distributed under the License is distributed on an "AS IS" basis,
+ * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
+ * for the specific language governing rights and limitations under the
+ * License.
+ *
+ * The Original Code is Mozilla XML-RPC Client component.
+ *
+ * The Initial Developer of the Original Code is
+ * Digital Creations 2, Inc.
+ * Portions created by the Initial Developer are Copyright (C) 2000
+ * the Initial Developer. All Rights Reserved.
+ *
+ * Contributor(s):
+ *   Martijn Pieters <mj@digicool.com> (original author)
+ *   Samuel Sieb <samuel@sieb.net>
+ *
+ * Alternatively, the contents of this file may be used under the terms of
+ * either the GNU General Public License Version 2 or later (the "GPL"), or
+ * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
+ * in which case the provisions of the GPL or the LGPL are applicable instead
+ * of those above. If you wish to allow use of your version of this file only
+ * under the terms of either the GPL or the LGPL, and not to allow others to
+ * use your version of this file under the terms of the MPL, indicate your
+ * decision by deleting the provisions above and replace them with the notice
+ * and other provisions required by the GPL or the LGPL. If you do not delete
+ * the provisions above, a recipient may use your version of this file under
+ * the terms of any one of the MPL, the GPL or the LGPL.
+ *
+ * ***** END LICENSE BLOCK ***** */
+
+// From: http://lxr.mozilla.org/mozilla/source/extensions/xml-rpc/src/nsXmlRpcClient.js#956
+
+/* Convert data (an array of integers) to a Base64 string. */
+var toBase64Table = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/';
+var base64Pad = '=';
+
+function toBase64(data) {
+    var result = '';
+    var length = data.length;
+    var i;
+    // Convert every three bytes to 4 ascii characters.
+    for (i = 0; i < (length - 2); i += 3) {
+        result += toBase64Table[data[i] >> 2];
+        result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+        result += toBase64Table[((data[i+1] & 0x0f) << 2) + (data[i+2] >> 6)];
+        result += toBase64Table[data[i+2] & 0x3f];
+    }
+
+    // Convert the remaining 1 or 2 bytes, pad out to 4 characters.
+    if (length%3) {
+        i = length - (length%3);
+        result += toBase64Table[data[i] >> 2];
+        if ((length%3) == 2) {
+            result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+            result += toBase64Table[(data[i+1] & 0x0f) << 2];
+            result += base64Pad;
+        } else {
+            result += toBase64Table[(data[i] & 0x03) << 4];
+            result += base64Pad + base64Pad;
+        }
+    }
+
+    return result;
+}
+
+/* Convert Base64 data to a string */
+var toBinaryTable = [
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,62, -1,-1,-1,63,
+    52,53,54,55, 56,57,58,59, 60,61,-1,-1, -1, 0,-1,-1,
+    -1, 0, 1, 2,  3, 4, 5, 6,  7, 8, 9,10, 11,12,13,14,
+    15,16,17,18, 19,20,21,22, 23,24,25,-1, -1,-1,-1,-1,
+    -1,26,27,28, 29,30,31,32, 33,34,35,36, 37,38,39,40,
+    41,42,43,44, 45,46,47,48, 49,50,51,-1, -1,-1,-1,-1
+];
+
+function base64ToString(data) {
+    var result = '';
+    var leftbits = 0; // number of bits decoded, but yet to be appended
+    var leftdata = 0; // bits decoded, but yet to be appended
+
+    // Convert one by one.
+    for (var i = 0; i < data.length; i++) {
+        var c = toBinaryTable[data.charCodeAt(i) & 0x7f];
+        var padding = (data[i] == base64Pad);
+        // Skip illegal characters and whitespace
+        if (c == -1) continue;
+        
+        // Collect data into leftdata, update bitcount
+        leftdata = (leftdata << 6) | c;
+        leftbits += 6;
+
+        // If we have 8 or more bits, append 8 bits to the result
+        if (leftbits >= 8) {
+            leftbits -= 8;
+            // Append if not padding.
+            if (!padding)
+                result += String.fromCharCode((leftdata >> leftbits) & 0xff);
+            leftdata &= (1 << leftbits) - 1;
+        }
+    }
+
+    // If there are any bits left, the base64 string was corrupted
+    if (leftbits)
+        throw Components.Exception('Corrupted base64 string');
+
+    return result;
+}
+
+startTest("real-base64");
+
+var str = "";
+
+for ( var i = 0; i < 2048; i++ )
+        str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 2048; i <= 16384; i *= 2 ) (function(i){
+
+	var base64;
+
+	test( "Convert String to Base 64", i, function(){
+		base64 = toBase64(str);
+	});
+
+	if ( !base64 )
+		base64 = toBase64(str);
+
+	test( "Convert Base 64 to String", i, function(){
+		base64ToString(base64);
+	});
+
+	// Double the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-base64-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-2.html
new file mode 100644
index 00000000000..feee45daf92
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-2.html
@@ -0,0 +1,155 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Convert Base 64 to String', onlyNum = 2048;
+function thisTest() {
+
+/* ***** BEGIN LICENSE BLOCK *****
+ * Version: MPL 1.1/GPL 2.0/LGPL 2.1
+ *
+ * The contents of this file are subject to the Mozilla Public License Version
+ * 1.1 (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ * http://www.mozilla.org/MPL/
+ *
+ * Software distributed under the License is distributed on an "AS IS" basis,
+ * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
+ * for the specific language governing rights and limitations under the
+ * License.
+ *
+ * The Original Code is Mozilla XML-RPC Client component.
+ *
+ * The Initial Developer of the Original Code is
+ * Digital Creations 2, Inc.
+ * Portions created by the Initial Developer are Copyright (C) 2000
+ * the Initial Developer. All Rights Reserved.
+ *
+ * Contributor(s):
+ *   Martijn Pieters <mj@digicool.com> (original author)
+ *   Samuel Sieb <samuel@sieb.net>
+ *
+ * Alternatively, the contents of this file may be used under the terms of
+ * either the GNU General Public License Version 2 or later (the "GPL"), or
+ * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
+ * in which case the provisions of the GPL or the LGPL are applicable instead
+ * of those above. If you wish to allow use of your version of this file only
+ * under the terms of either the GPL or the LGPL, and not to allow others to
+ * use your version of this file under the terms of the MPL, indicate your
+ * decision by deleting the provisions above and replace them with the notice
+ * and other provisions required by the GPL or the LGPL. If you do not delete
+ * the provisions above, a recipient may use your version of this file under
+ * the terms of any one of the MPL, the GPL or the LGPL.
+ *
+ * ***** END LICENSE BLOCK ***** */
+
+// From: http://lxr.mozilla.org/mozilla/source/extensions/xml-rpc/src/nsXmlRpcClient.js#956
+
+/* Convert data (an array of integers) to a Base64 string. */
+var toBase64Table = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/';
+var base64Pad = '=';
+
+function toBase64(data) {
+    var result = '';
+    var length = data.length;
+    var i;
+    // Convert every three bytes to 4 ascii characters.
+    for (i = 0; i < (length - 2); i += 3) {
+        result += toBase64Table[data[i] >> 2];
+        result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+        result += toBase64Table[((data[i+1] & 0x0f) << 2) + (data[i+2] >> 6)];
+        result += toBase64Table[data[i+2] & 0x3f];
+    }
+
+    // Convert the remaining 1 or 2 bytes, pad out to 4 characters.
+    if (length%3) {
+        i = length - (length%3);
+        result += toBase64Table[data[i] >> 2];
+        if ((length%3) == 2) {
+            result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+            result += toBase64Table[(data[i+1] & 0x0f) << 2];
+            result += base64Pad;
+        } else {
+            result += toBase64Table[(data[i] & 0x03) << 4];
+            result += base64Pad + base64Pad;
+        }
+    }
+
+    return result;
+}
+
+/* Convert Base64 data to a string */
+var toBinaryTable = [
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,62, -1,-1,-1,63,
+    52,53,54,55, 56,57,58,59, 60,61,-1,-1, -1, 0,-1,-1,
+    -1, 0, 1, 2,  3, 4, 5, 6,  7, 8, 9,10, 11,12,13,14,
+    15,16,17,18, 19,20,21,22, 23,24,25,-1, -1,-1,-1,-1,
+    -1,26,27,28, 29,30,31,32, 33,34,35,36, 37,38,39,40,
+    41,42,43,44, 45,46,47,48, 49,50,51,-1, -1,-1,-1,-1
+];
+
+function base64ToString(data) {
+    var result = '';
+    var leftbits = 0; // number of bits decoded, but yet to be appended
+    var leftdata = 0; // bits decoded, but yet to be appended
+
+    // Convert one by one.
+    for (var i = 0; i < data.length; i++) {
+        var c = toBinaryTable[data.charCodeAt(i) & 0x7f];
+        var padding = (data[i] == base64Pad);
+        // Skip illegal characters and whitespace
+        if (c == -1) continue;
+        
+        // Collect data into leftdata, update bitcount
+        leftdata = (leftdata << 6) | c;
+        leftbits += 6;
+
+        // If we have 8 or more bits, append 8 bits to the result
+        if (leftbits >= 8) {
+            leftbits -= 8;
+            // Append if not padding.
+            if (!padding)
+                result += String.fromCharCode((leftdata >> leftbits) & 0xff);
+            leftdata &= (1 << leftbits) - 1;
+        }
+    }
+
+    // If there are any bits left, the base64 string was corrupted
+    if (leftbits)
+        throw Components.Exception('Corrupted base64 string');
+
+    return result;
+}
+
+startTest("real-base64");
+
+var str = "";
+
+for ( var i = 0; i < 2048; i++ )
+        str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 2048; i <= 16384; i *= 2 ) (function(i){
+
+	var base64;
+
+	test( "Convert String to Base 64", i, function(){
+		base64 = toBase64(str);
+	});
+
+	if ( !base64 )
+		base64 = toBase64(str);
+
+	test( "Convert Base 64 to String", i, function(){
+		base64ToString(base64);
+	});
+
+	// Double the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-base64-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-3.html
new file mode 100644
index 00000000000..a0ef197eb9d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-3.html
@@ -0,0 +1,155 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Convert String to Base 64', onlyNum = 4096;
+function thisTest() {
+
+/* ***** BEGIN LICENSE BLOCK *****
+ * Version: MPL 1.1/GPL 2.0/LGPL 2.1
+ *
+ * The contents of this file are subject to the Mozilla Public License Version
+ * 1.1 (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ * http://www.mozilla.org/MPL/
+ *
+ * Software distributed under the License is distributed on an "AS IS" basis,
+ * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
+ * for the specific language governing rights and limitations under the
+ * License.
+ *
+ * The Original Code is Mozilla XML-RPC Client component.
+ *
+ * The Initial Developer of the Original Code is
+ * Digital Creations 2, Inc.
+ * Portions created by the Initial Developer are Copyright (C) 2000
+ * the Initial Developer. All Rights Reserved.
+ *
+ * Contributor(s):
+ *   Martijn Pieters <mj@digicool.com> (original author)
+ *   Samuel Sieb <samuel@sieb.net>
+ *
+ * Alternatively, the contents of this file may be used under the terms of
+ * either the GNU General Public License Version 2 or later (the "GPL"), or
+ * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
+ * in which case the provisions of the GPL or the LGPL are applicable instead
+ * of those above. If you wish to allow use of your version of this file only
+ * under the terms of either the GPL or the LGPL, and not to allow others to
+ * use your version of this file under the terms of the MPL, indicate your
+ * decision by deleting the provisions above and replace them with the notice
+ * and other provisions required by the GPL or the LGPL. If you do not delete
+ * the provisions above, a recipient may use your version of this file under
+ * the terms of any one of the MPL, the GPL or the LGPL.
+ *
+ * ***** END LICENSE BLOCK ***** */
+
+// From: http://lxr.mozilla.org/mozilla/source/extensions/xml-rpc/src/nsXmlRpcClient.js#956
+
+/* Convert data (an array of integers) to a Base64 string. */
+var toBase64Table = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/';
+var base64Pad = '=';
+
+function toBase64(data) {
+    var result = '';
+    var length = data.length;
+    var i;
+    // Convert every three bytes to 4 ascii characters.
+    for (i = 0; i < (length - 2); i += 3) {
+        result += toBase64Table[data[i] >> 2];
+        result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+        result += toBase64Table[((data[i+1] & 0x0f) << 2) + (data[i+2] >> 6)];
+        result += toBase64Table[data[i+2] & 0x3f];
+    }
+
+    // Convert the remaining 1 or 2 bytes, pad out to 4 characters.
+    if (length%3) {
+        i = length - (length%3);
+        result += toBase64Table[data[i] >> 2];
+        if ((length%3) == 2) {
+            result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+            result += toBase64Table[(data[i+1] & 0x0f) << 2];
+            result += base64Pad;
+        } else {
+            result += toBase64Table[(data[i] & 0x03) << 4];
+            result += base64Pad + base64Pad;
+        }
+    }
+
+    return result;
+}
+
+/* Convert Base64 data to a string */
+var toBinaryTable = [
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,62, -1,-1,-1,63,
+    52,53,54,55, 56,57,58,59, 60,61,-1,-1, -1, 0,-1,-1,
+    -1, 0, 1, 2,  3, 4, 5, 6,  7, 8, 9,10, 11,12,13,14,
+    15,16,17,18, 19,20,21,22, 23,24,25,-1, -1,-1,-1,-1,
+    -1,26,27,28, 29,30,31,32, 33,34,35,36, 37,38,39,40,
+    41,42,43,44, 45,46,47,48, 49,50,51,-1, -1,-1,-1,-1
+];
+
+function base64ToString(data) {
+    var result = '';
+    var leftbits = 0; // number of bits decoded, but yet to be appended
+    var leftdata = 0; // bits decoded, but yet to be appended
+
+    // Convert one by one.
+    for (var i = 0; i < data.length; i++) {
+        var c = toBinaryTable[data.charCodeAt(i) & 0x7f];
+        var padding = (data[i] == base64Pad);
+        // Skip illegal characters and whitespace
+        if (c == -1) continue;
+        
+        // Collect data into leftdata, update bitcount
+        leftdata = (leftdata << 6) | c;
+        leftbits += 6;
+
+        // If we have 8 or more bits, append 8 bits to the result
+        if (leftbits >= 8) {
+            leftbits -= 8;
+            // Append if not padding.
+            if (!padding)
+                result += String.fromCharCode((leftdata >> leftbits) & 0xff);
+            leftdata &= (1 << leftbits) - 1;
+        }
+    }
+
+    // If there are any bits left, the base64 string was corrupted
+    if (leftbits)
+        throw Components.Exception('Corrupted base64 string');
+
+    return result;
+}
+
+startTest("real-base64");
+
+var str = "";
+
+for ( var i = 0; i < 2048; i++ )
+        str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 2048; i <= 16384; i *= 2 ) (function(i){
+
+	var base64;
+
+	test( "Convert String to Base 64", i, function(){
+		base64 = toBase64(str);
+	});
+
+	if ( !base64 )
+		base64 = toBase64(str);
+
+	test( "Convert Base 64 to String", i, function(){
+		base64ToString(base64);
+	});
+
+	// Double the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-base64-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-4.html
new file mode 100644
index 00000000000..78e197cc5cc
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-4.html
@@ -0,0 +1,155 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Convert Base 64 to String', onlyNum = 4096;
+function thisTest() {
+
+/* ***** BEGIN LICENSE BLOCK *****
+ * Version: MPL 1.1/GPL 2.0/LGPL 2.1
+ *
+ * The contents of this file are subject to the Mozilla Public License Version
+ * 1.1 (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ * http://www.mozilla.org/MPL/
+ *
+ * Software distributed under the License is distributed on an "AS IS" basis,
+ * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
+ * for the specific language governing rights and limitations under the
+ * License.
+ *
+ * The Original Code is Mozilla XML-RPC Client component.
+ *
+ * The Initial Developer of the Original Code is
+ * Digital Creations 2, Inc.
+ * Portions created by the Initial Developer are Copyright (C) 2000
+ * the Initial Developer. All Rights Reserved.
+ *
+ * Contributor(s):
+ *   Martijn Pieters <mj@digicool.com> (original author)
+ *   Samuel Sieb <samuel@sieb.net>
+ *
+ * Alternatively, the contents of this file may be used under the terms of
+ * either the GNU General Public License Version 2 or later (the "GPL"), or
+ * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
+ * in which case the provisions of the GPL or the LGPL are applicable instead
+ * of those above. If you wish to allow use of your version of this file only
+ * under the terms of either the GPL or the LGPL, and not to allow others to
+ * use your version of this file under the terms of the MPL, indicate your
+ * decision by deleting the provisions above and replace them with the notice
+ * and other provisions required by the GPL or the LGPL. If you do not delete
+ * the provisions above, a recipient may use your version of this file under
+ * the terms of any one of the MPL, the GPL or the LGPL.
+ *
+ * ***** END LICENSE BLOCK ***** */
+
+// From: http://lxr.mozilla.org/mozilla/source/extensions/xml-rpc/src/nsXmlRpcClient.js#956
+
+/* Convert data (an array of integers) to a Base64 string. */
+var toBase64Table = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/';
+var base64Pad = '=';
+
+function toBase64(data) {
+    var result = '';
+    var length = data.length;
+    var i;
+    // Convert every three bytes to 4 ascii characters.
+    for (i = 0; i < (length - 2); i += 3) {
+        result += toBase64Table[data[i] >> 2];
+        result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+        result += toBase64Table[((data[i+1] & 0x0f) << 2) + (data[i+2] >> 6)];
+        result += toBase64Table[data[i+2] & 0x3f];
+    }
+
+    // Convert the remaining 1 or 2 bytes, pad out to 4 characters.
+    if (length%3) {
+        i = length - (length%3);
+        result += toBase64Table[data[i] >> 2];
+        if ((length%3) == 2) {
+            result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+            result += toBase64Table[(data[i+1] & 0x0f) << 2];
+            result += base64Pad;
+        } else {
+            result += toBase64Table[(data[i] & 0x03) << 4];
+            result += base64Pad + base64Pad;
+        }
+    }
+
+    return result;
+}
+
+/* Convert Base64 data to a string */
+var toBinaryTable = [
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,62, -1,-1,-1,63,
+    52,53,54,55, 56,57,58,59, 60,61,-1,-1, -1, 0,-1,-1,
+    -1, 0, 1, 2,  3, 4, 5, 6,  7, 8, 9,10, 11,12,13,14,
+    15,16,17,18, 19,20,21,22, 23,24,25,-1, -1,-1,-1,-1,
+    -1,26,27,28, 29,30,31,32, 33,34,35,36, 37,38,39,40,
+    41,42,43,44, 45,46,47,48, 49,50,51,-1, -1,-1,-1,-1
+];
+
+function base64ToString(data) {
+    var result = '';
+    var leftbits = 0; // number of bits decoded, but yet to be appended
+    var leftdata = 0; // bits decoded, but yet to be appended
+
+    // Convert one by one.
+    for (var i = 0; i < data.length; i++) {
+        var c = toBinaryTable[data.charCodeAt(i) & 0x7f];
+        var padding = (data[i] == base64Pad);
+        // Skip illegal characters and whitespace
+        if (c == -1) continue;
+        
+        // Collect data into leftdata, update bitcount
+        leftdata = (leftdata << 6) | c;
+        leftbits += 6;
+
+        // If we have 8 or more bits, append 8 bits to the result
+        if (leftbits >= 8) {
+            leftbits -= 8;
+            // Append if not padding.
+            if (!padding)
+                result += String.fromCharCode((leftdata >> leftbits) & 0xff);
+            leftdata &= (1 << leftbits) - 1;
+        }
+    }
+
+    // If there are any bits left, the base64 string was corrupted
+    if (leftbits)
+        throw Components.Exception('Corrupted base64 string');
+
+    return result;
+}
+
+startTest("real-base64");
+
+var str = "";
+
+for ( var i = 0; i < 2048; i++ )
+        str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 2048; i <= 16384; i *= 2 ) (function(i){
+
+	var base64;
+
+	test( "Convert String to Base 64", i, function(){
+		base64 = toBase64(str);
+	});
+
+	if ( !base64 )
+		base64 = toBase64(str);
+
+	test( "Convert Base 64 to String", i, function(){
+		base64ToString(base64);
+	});
+
+	// Double the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-base64-5.html b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-5.html
new file mode 100644
index 00000000000..c34dc620c41
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-5.html
@@ -0,0 +1,155 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Convert String to Base 64', onlyNum = 8192;
+function thisTest() {
+
+/* ***** BEGIN LICENSE BLOCK *****
+ * Version: MPL 1.1/GPL 2.0/LGPL 2.1
+ *
+ * The contents of this file are subject to the Mozilla Public License Version
+ * 1.1 (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ * http://www.mozilla.org/MPL/
+ *
+ * Software distributed under the License is distributed on an "AS IS" basis,
+ * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
+ * for the specific language governing rights and limitations under the
+ * License.
+ *
+ * The Original Code is Mozilla XML-RPC Client component.
+ *
+ * The Initial Developer of the Original Code is
+ * Digital Creations 2, Inc.
+ * Portions created by the Initial Developer are Copyright (C) 2000
+ * the Initial Developer. All Rights Reserved.
+ *
+ * Contributor(s):
+ *   Martijn Pieters <mj@digicool.com> (original author)
+ *   Samuel Sieb <samuel@sieb.net>
+ *
+ * Alternatively, the contents of this file may be used under the terms of
+ * either the GNU General Public License Version 2 or later (the "GPL"), or
+ * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
+ * in which case the provisions of the GPL or the LGPL are applicable instead
+ * of those above. If you wish to allow use of your version of this file only
+ * under the terms of either the GPL or the LGPL, and not to allow others to
+ * use your version of this file under the terms of the MPL, indicate your
+ * decision by deleting the provisions above and replace them with the notice
+ * and other provisions required by the GPL or the LGPL. If you do not delete
+ * the provisions above, a recipient may use your version of this file under
+ * the terms of any one of the MPL, the GPL or the LGPL.
+ *
+ * ***** END LICENSE BLOCK ***** */
+
+// From: http://lxr.mozilla.org/mozilla/source/extensions/xml-rpc/src/nsXmlRpcClient.js#956
+
+/* Convert data (an array of integers) to a Base64 string. */
+var toBase64Table = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/';
+var base64Pad = '=';
+
+function toBase64(data) {
+    var result = '';
+    var length = data.length;
+    var i;
+    // Convert every three bytes to 4 ascii characters.
+    for (i = 0; i < (length - 2); i += 3) {
+        result += toBase64Table[data[i] >> 2];
+        result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+        result += toBase64Table[((data[i+1] & 0x0f) << 2) + (data[i+2] >> 6)];
+        result += toBase64Table[data[i+2] & 0x3f];
+    }
+
+    // Convert the remaining 1 or 2 bytes, pad out to 4 characters.
+    if (length%3) {
+        i = length - (length%3);
+        result += toBase64Table[data[i] >> 2];
+        if ((length%3) == 2) {
+            result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+            result += toBase64Table[(data[i+1] & 0x0f) << 2];
+            result += base64Pad;
+        } else {
+            result += toBase64Table[(data[i] & 0x03) << 4];
+            result += base64Pad + base64Pad;
+        }
+    }
+
+    return result;
+}
+
+/* Convert Base64 data to a string */
+var toBinaryTable = [
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,62, -1,-1,-1,63,
+    52,53,54,55, 56,57,58,59, 60,61,-1,-1, -1, 0,-1,-1,
+    -1, 0, 1, 2,  3, 4, 5, 6,  7, 8, 9,10, 11,12,13,14,
+    15,16,17,18, 19,20,21,22, 23,24,25,-1, -1,-1,-1,-1,
+    -1,26,27,28, 29,30,31,32, 33,34,35,36, 37,38,39,40,
+    41,42,43,44, 45,46,47,48, 49,50,51,-1, -1,-1,-1,-1
+];
+
+function base64ToString(data) {
+    var result = '';
+    var leftbits = 0; // number of bits decoded, but yet to be appended
+    var leftdata = 0; // bits decoded, but yet to be appended
+
+    // Convert one by one.
+    for (var i = 0; i < data.length; i++) {
+        var c = toBinaryTable[data.charCodeAt(i) & 0x7f];
+        var padding = (data[i] == base64Pad);
+        // Skip illegal characters and whitespace
+        if (c == -1) continue;
+        
+        // Collect data into leftdata, update bitcount
+        leftdata = (leftdata << 6) | c;
+        leftbits += 6;
+
+        // If we have 8 or more bits, append 8 bits to the result
+        if (leftbits >= 8) {
+            leftbits -= 8;
+            // Append if not padding.
+            if (!padding)
+                result += String.fromCharCode((leftdata >> leftbits) & 0xff);
+            leftdata &= (1 << leftbits) - 1;
+        }
+    }
+
+    // If there are any bits left, the base64 string was corrupted
+    if (leftbits)
+        throw Components.Exception('Corrupted base64 string');
+
+    return result;
+}
+
+startTest("real-base64");
+
+var str = "";
+
+for ( var i = 0; i < 2048; i++ )
+        str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 2048; i <= 16384; i *= 2 ) (function(i){
+
+	var base64;
+
+	test( "Convert String to Base 64", i, function(){
+		base64 = toBase64(str);
+	});
+
+	if ( !base64 )
+		base64 = toBase64(str);
+
+	test( "Convert Base 64 to String", i, function(){
+		base64ToString(base64);
+	});
+
+	// Double the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-base64-6.html b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-6.html
new file mode 100644
index 00000000000..298db1584f6
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-6.html
@@ -0,0 +1,155 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Convert Base 64 to String', onlyNum = 8192;
+function thisTest() {
+
+/* ***** BEGIN LICENSE BLOCK *****
+ * Version: MPL 1.1/GPL 2.0/LGPL 2.1
+ *
+ * The contents of this file are subject to the Mozilla Public License Version
+ * 1.1 (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ * http://www.mozilla.org/MPL/
+ *
+ * Software distributed under the License is distributed on an "AS IS" basis,
+ * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
+ * for the specific language governing rights and limitations under the
+ * License.
+ *
+ * The Original Code is Mozilla XML-RPC Client component.
+ *
+ * The Initial Developer of the Original Code is
+ * Digital Creations 2, Inc.
+ * Portions created by the Initial Developer are Copyright (C) 2000
+ * the Initial Developer. All Rights Reserved.
+ *
+ * Contributor(s):
+ *   Martijn Pieters <mj@digicool.com> (original author)
+ *   Samuel Sieb <samuel@sieb.net>
+ *
+ * Alternatively, the contents of this file may be used under the terms of
+ * either the GNU General Public License Version 2 or later (the "GPL"), or
+ * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
+ * in which case the provisions of the GPL or the LGPL are applicable instead
+ * of those above. If you wish to allow use of your version of this file only
+ * under the terms of either the GPL or the LGPL, and not to allow others to
+ * use your version of this file under the terms of the MPL, indicate your
+ * decision by deleting the provisions above and replace them with the notice
+ * and other provisions required by the GPL or the LGPL. If you do not delete
+ * the provisions above, a recipient may use your version of this file under
+ * the terms of any one of the MPL, the GPL or the LGPL.
+ *
+ * ***** END LICENSE BLOCK ***** */
+
+// From: http://lxr.mozilla.org/mozilla/source/extensions/xml-rpc/src/nsXmlRpcClient.js#956
+
+/* Convert data (an array of integers) to a Base64 string. */
+var toBase64Table = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/';
+var base64Pad = '=';
+
+function toBase64(data) {
+    var result = '';
+    var length = data.length;
+    var i;
+    // Convert every three bytes to 4 ascii characters.
+    for (i = 0; i < (length - 2); i += 3) {
+        result += toBase64Table[data[i] >> 2];
+        result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+        result += toBase64Table[((data[i+1] & 0x0f) << 2) + (data[i+2] >> 6)];
+        result += toBase64Table[data[i+2] & 0x3f];
+    }
+
+    // Convert the remaining 1 or 2 bytes, pad out to 4 characters.
+    if (length%3) {
+        i = length - (length%3);
+        result += toBase64Table[data[i] >> 2];
+        if ((length%3) == 2) {
+            result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+            result += toBase64Table[(data[i+1] & 0x0f) << 2];
+            result += base64Pad;
+        } else {
+            result += toBase64Table[(data[i] & 0x03) << 4];
+            result += base64Pad + base64Pad;
+        }
+    }
+
+    return result;
+}
+
+/* Convert Base64 data to a string */
+var toBinaryTable = [
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,62, -1,-1,-1,63,
+    52,53,54,55, 56,57,58,59, 60,61,-1,-1, -1, 0,-1,-1,
+    -1, 0, 1, 2,  3, 4, 5, 6,  7, 8, 9,10, 11,12,13,14,
+    15,16,17,18, 19,20,21,22, 23,24,25,-1, -1,-1,-1,-1,
+    -1,26,27,28, 29,30,31,32, 33,34,35,36, 37,38,39,40,
+    41,42,43,44, 45,46,47,48, 49,50,51,-1, -1,-1,-1,-1
+];
+
+function base64ToString(data) {
+    var result = '';
+    var leftbits = 0; // number of bits decoded, but yet to be appended
+    var leftdata = 0; // bits decoded, but yet to be appended
+
+    // Convert one by one.
+    for (var i = 0; i < data.length; i++) {
+        var c = toBinaryTable[data.charCodeAt(i) & 0x7f];
+        var padding = (data[i] == base64Pad);
+        // Skip illegal characters and whitespace
+        if (c == -1) continue;
+        
+        // Collect data into leftdata, update bitcount
+        leftdata = (leftdata << 6) | c;
+        leftbits += 6;
+
+        // If we have 8 or more bits, append 8 bits to the result
+        if (leftbits >= 8) {
+            leftbits -= 8;
+            // Append if not padding.
+            if (!padding)
+                result += String.fromCharCode((leftdata >> leftbits) & 0xff);
+            leftdata &= (1 << leftbits) - 1;
+        }
+    }
+
+    // If there are any bits left, the base64 string was corrupted
+    if (leftbits)
+        throw Components.Exception('Corrupted base64 string');
+
+    return result;
+}
+
+startTest("real-base64");
+
+var str = "";
+
+for ( var i = 0; i < 2048; i++ )
+        str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 2048; i <= 16384; i *= 2 ) (function(i){
+
+	var base64;
+
+	test( "Convert String to Base 64", i, function(){
+		base64 = toBase64(str);
+	});
+
+	if ( !base64 )
+		base64 = toBase64(str);
+
+	test( "Convert Base 64 to String", i, function(){
+		base64ToString(base64);
+	});
+
+	// Double the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-base64-7.html b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-7.html
new file mode 100644
index 00000000000..a89b8fa3044
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-7.html
@@ -0,0 +1,155 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Convert String to Base 64', onlyNum = 16384;
+function thisTest() {
+
+/* ***** BEGIN LICENSE BLOCK *****
+ * Version: MPL 1.1/GPL 2.0/LGPL 2.1
+ *
+ * The contents of this file are subject to the Mozilla Public License Version
+ * 1.1 (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ * http://www.mozilla.org/MPL/
+ *
+ * Software distributed under the License is distributed on an "AS IS" basis,
+ * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
+ * for the specific language governing rights and limitations under the
+ * License.
+ *
+ * The Original Code is Mozilla XML-RPC Client component.
+ *
+ * The Initial Developer of the Original Code is
+ * Digital Creations 2, Inc.
+ * Portions created by the Initial Developer are Copyright (C) 2000
+ * the Initial Developer. All Rights Reserved.
+ *
+ * Contributor(s):
+ *   Martijn Pieters <mj@digicool.com> (original author)
+ *   Samuel Sieb <samuel@sieb.net>
+ *
+ * Alternatively, the contents of this file may be used under the terms of
+ * either the GNU General Public License Version 2 or later (the "GPL"), or
+ * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
+ * in which case the provisions of the GPL or the LGPL are applicable instead
+ * of those above. If you wish to allow use of your version of this file only
+ * under the terms of either the GPL or the LGPL, and not to allow others to
+ * use your version of this file under the terms of the MPL, indicate your
+ * decision by deleting the provisions above and replace them with the notice
+ * and other provisions required by the GPL or the LGPL. If you do not delete
+ * the provisions above, a recipient may use your version of this file under
+ * the terms of any one of the MPL, the GPL or the LGPL.
+ *
+ * ***** END LICENSE BLOCK ***** */
+
+// From: http://lxr.mozilla.org/mozilla/source/extensions/xml-rpc/src/nsXmlRpcClient.js#956
+
+/* Convert data (an array of integers) to a Base64 string. */
+var toBase64Table = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/';
+var base64Pad = '=';
+
+function toBase64(data) {
+    var result = '';
+    var length = data.length;
+    var i;
+    // Convert every three bytes to 4 ascii characters.
+    for (i = 0; i < (length - 2); i += 3) {
+        result += toBase64Table[data[i] >> 2];
+        result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+        result += toBase64Table[((data[i+1] & 0x0f) << 2) + (data[i+2] >> 6)];
+        result += toBase64Table[data[i+2] & 0x3f];
+    }
+
+    // Convert the remaining 1 or 2 bytes, pad out to 4 characters.
+    if (length%3) {
+        i = length - (length%3);
+        result += toBase64Table[data[i] >> 2];
+        if ((length%3) == 2) {
+            result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+            result += toBase64Table[(data[i+1] & 0x0f) << 2];
+            result += base64Pad;
+        } else {
+            result += toBase64Table[(data[i] & 0x03) << 4];
+            result += base64Pad + base64Pad;
+        }
+    }
+
+    return result;
+}
+
+/* Convert Base64 data to a string */
+var toBinaryTable = [
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,62, -1,-1,-1,63,
+    52,53,54,55, 56,57,58,59, 60,61,-1,-1, -1, 0,-1,-1,
+    -1, 0, 1, 2,  3, 4, 5, 6,  7, 8, 9,10, 11,12,13,14,
+    15,16,17,18, 19,20,21,22, 23,24,25,-1, -1,-1,-1,-1,
+    -1,26,27,28, 29,30,31,32, 33,34,35,36, 37,38,39,40,
+    41,42,43,44, 45,46,47,48, 49,50,51,-1, -1,-1,-1,-1
+];
+
+function base64ToString(data) {
+    var result = '';
+    var leftbits = 0; // number of bits decoded, but yet to be appended
+    var leftdata = 0; // bits decoded, but yet to be appended
+
+    // Convert one by one.
+    for (var i = 0; i < data.length; i++) {
+        var c = toBinaryTable[data.charCodeAt(i) & 0x7f];
+        var padding = (data[i] == base64Pad);
+        // Skip illegal characters and whitespace
+        if (c == -1) continue;
+        
+        // Collect data into leftdata, update bitcount
+        leftdata = (leftdata << 6) | c;
+        leftbits += 6;
+
+        // If we have 8 or more bits, append 8 bits to the result
+        if (leftbits >= 8) {
+            leftbits -= 8;
+            // Append if not padding.
+            if (!padding)
+                result += String.fromCharCode((leftdata >> leftbits) & 0xff);
+            leftdata &= (1 << leftbits) - 1;
+        }
+    }
+
+    // If there are any bits left, the base64 string was corrupted
+    if (leftbits)
+        throw Components.Exception('Corrupted base64 string');
+
+    return result;
+}
+
+startTest("real-base64");
+
+var str = "";
+
+for ( var i = 0; i < 2048; i++ )
+        str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 2048; i <= 16384; i *= 2 ) (function(i){
+
+	var base64;
+
+	test( "Convert String to Base 64", i, function(){
+		base64 = toBase64(str);
+	});
+
+	if ( !base64 )
+		base64 = toBase64(str);
+
+	test( "Convert Base 64 to String", i, function(){
+		base64ToString(base64);
+	});
+
+	// Double the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-base64-8.html b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-8.html
new file mode 100644
index 00000000000..13f0fb500bd
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-base64-8.html
@@ -0,0 +1,155 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Convert Base 64 to String', onlyNum = 16384;
+function thisTest() {
+
+/* ***** BEGIN LICENSE BLOCK *****
+ * Version: MPL 1.1/GPL 2.0/LGPL 2.1
+ *
+ * The contents of this file are subject to the Mozilla Public License Version
+ * 1.1 (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ * http://www.mozilla.org/MPL/
+ *
+ * Software distributed under the License is distributed on an "AS IS" basis,
+ * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
+ * for the specific language governing rights and limitations under the
+ * License.
+ *
+ * The Original Code is Mozilla XML-RPC Client component.
+ *
+ * The Initial Developer of the Original Code is
+ * Digital Creations 2, Inc.
+ * Portions created by the Initial Developer are Copyright (C) 2000
+ * the Initial Developer. All Rights Reserved.
+ *
+ * Contributor(s):
+ *   Martijn Pieters <mj@digicool.com> (original author)
+ *   Samuel Sieb <samuel@sieb.net>
+ *
+ * Alternatively, the contents of this file may be used under the terms of
+ * either the GNU General Public License Version 2 or later (the "GPL"), or
+ * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
+ * in which case the provisions of the GPL or the LGPL are applicable instead
+ * of those above. If you wish to allow use of your version of this file only
+ * under the terms of either the GPL or the LGPL, and not to allow others to
+ * use your version of this file under the terms of the MPL, indicate your
+ * decision by deleting the provisions above and replace them with the notice
+ * and other provisions required by the GPL or the LGPL. If you do not delete
+ * the provisions above, a recipient may use your version of this file under
+ * the terms of any one of the MPL, the GPL or the LGPL.
+ *
+ * ***** END LICENSE BLOCK ***** */
+
+// From: http://lxr.mozilla.org/mozilla/source/extensions/xml-rpc/src/nsXmlRpcClient.js#956
+
+/* Convert data (an array of integers) to a Base64 string. */
+var toBase64Table = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/';
+var base64Pad = '=';
+
+function toBase64(data) {
+    var result = '';
+    var length = data.length;
+    var i;
+    // Convert every three bytes to 4 ascii characters.
+    for (i = 0; i < (length - 2); i += 3) {
+        result += toBase64Table[data[i] >> 2];
+        result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+        result += toBase64Table[((data[i+1] & 0x0f) << 2) + (data[i+2] >> 6)];
+        result += toBase64Table[data[i+2] & 0x3f];
+    }
+
+    // Convert the remaining 1 or 2 bytes, pad out to 4 characters.
+    if (length%3) {
+        i = length - (length%3);
+        result += toBase64Table[data[i] >> 2];
+        if ((length%3) == 2) {
+            result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)];
+            result += toBase64Table[(data[i+1] & 0x0f) << 2];
+            result += base64Pad;
+        } else {
+            result += toBase64Table[(data[i] & 0x03) << 4];
+            result += base64Pad + base64Pad;
+        }
+    }
+
+    return result;
+}
+
+/* Convert Base64 data to a string */
+var toBinaryTable = [
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,62, -1,-1,-1,63,
+    52,53,54,55, 56,57,58,59, 60,61,-1,-1, -1, 0,-1,-1,
+    -1, 0, 1, 2,  3, 4, 5, 6,  7, 8, 9,10, 11,12,13,14,
+    15,16,17,18, 19,20,21,22, 23,24,25,-1, -1,-1,-1,-1,
+    -1,26,27,28, 29,30,31,32, 33,34,35,36, 37,38,39,40,
+    41,42,43,44, 45,46,47,48, 49,50,51,-1, -1,-1,-1,-1
+];
+
+function base64ToString(data) {
+    var result = '';
+    var leftbits = 0; // number of bits decoded, but yet to be appended
+    var leftdata = 0; // bits decoded, but yet to be appended
+
+    // Convert one by one.
+    for (var i = 0; i < data.length; i++) {
+        var c = toBinaryTable[data.charCodeAt(i) & 0x7f];
+        var padding = (data[i] == base64Pad);
+        // Skip illegal characters and whitespace
+        if (c == -1) continue;
+        
+        // Collect data into leftdata, update bitcount
+        leftdata = (leftdata << 6) | c;
+        leftbits += 6;
+
+        // If we have 8 or more bits, append 8 bits to the result
+        if (leftbits >= 8) {
+            leftbits -= 8;
+            // Append if not padding.
+            if (!padding)
+                result += String.fromCharCode((leftdata >> leftbits) & 0xff);
+            leftdata &= (1 << leftbits) - 1;
+        }
+    }
+
+    // If there are any bits left, the base64 string was corrupted
+    if (leftbits)
+        throw Components.Exception('Corrupted base64 string');
+
+    return result;
+}
+
+startTest("real-base64");
+
+var str = "";
+
+for ( var i = 0; i < 2048; i++ )
+        str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 2048; i <= 16384; i *= 2 ) (function(i){
+
+	var base64;
+
+	test( "Convert String to Base 64", i, function(){
+		base64 = toBase64(str);
+	});
+
+	if ( !base64 )
+		base64 = toBase64(str);
+
+	test( "Convert Base 64 to String", i, function(){
+		base64ToString(base64);
+	});
+
+	// Double the string
+	str += str;
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-1.html
new file mode 100644
index 00000000000..ee90411eb63
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-1.html
@@ -0,0 +1,66 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Binary Trees', onlyNum = 2;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function TreeNode(left,right,item){
+   this.left = left;
+   this.right = right;
+   this.item = item;
+}
+
+TreeNode.prototype.itemCheck = function(){
+   if (this.left==null) return this.item;
+   else return this.item + this.left.itemCheck() - this.right.itemCheck();
+}
+
+function bottomUpTree(item,depth){
+   if (depth>0){
+      return new TreeNode(
+          bottomUpTree(2*item-1, depth-1)
+         ,bottomUpTree(2*item, depth-1)
+         ,item
+      );
+   }
+   else {
+      return new TreeNode(null,null,item);
+   }
+}
+
+startTest("real-binary-trees");
+
+var ret;
+
+for ( var n = 2; n <= 8; n *= 2 ) (function(n){
+	test( "Binary Trees", n, function(){
+		var minDepth = 4;
+		var maxDepth = Math.max(minDepth + 2, n);
+		var stretchDepth = maxDepth + 1;
+		
+		var check = bottomUpTree(0,stretchDepth).itemCheck();
+		
+		var longLivedTree = bottomUpTree(0,maxDepth);
+		for (var depth=minDepth; depth<=maxDepth; depth+=2){
+		   var iterations = 1 << (maxDepth - depth + minDepth);
+		
+		   check = 0;
+		   for (var i=1; i<=iterations; i++){
+			  check += bottomUpTree(i,depth).itemCheck();
+			  check += bottomUpTree(-i,depth).itemCheck();
+		   }
+		}
+		
+		ret = longLivedTree.itemCheck();
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-2.html
new file mode 100644
index 00000000000..c94bf885b92
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-2.html
@@ -0,0 +1,66 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Binary Trees', onlyNum = 4;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function TreeNode(left,right,item){
+   this.left = left;
+   this.right = right;
+   this.item = item;
+}
+
+TreeNode.prototype.itemCheck = function(){
+   if (this.left==null) return this.item;
+   else return this.item + this.left.itemCheck() - this.right.itemCheck();
+}
+
+function bottomUpTree(item,depth){
+   if (depth>0){
+      return new TreeNode(
+          bottomUpTree(2*item-1, depth-1)
+         ,bottomUpTree(2*item, depth-1)
+         ,item
+      );
+   }
+   else {
+      return new TreeNode(null,null,item);
+   }
+}
+
+startTest("real-binary-trees");
+
+var ret;
+
+for ( var n = 2; n <= 8; n *= 2 ) (function(n){
+	test( "Binary Trees", n, function(){
+		var minDepth = 4;
+		var maxDepth = Math.max(minDepth + 2, n);
+		var stretchDepth = maxDepth + 1;
+		
+		var check = bottomUpTree(0,stretchDepth).itemCheck();
+		
+		var longLivedTree = bottomUpTree(0,maxDepth);
+		for (var depth=minDepth; depth<=maxDepth; depth+=2){
+		   var iterations = 1 << (maxDepth - depth + minDepth);
+		
+		   check = 0;
+		   for (var i=1; i<=iterations; i++){
+			  check += bottomUpTree(i,depth).itemCheck();
+			  check += bottomUpTree(-i,depth).itemCheck();
+		   }
+		}
+		
+		ret = longLivedTree.itemCheck();
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-3.html
new file mode 100644
index 00000000000..f6380f9c3c7
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-binary-trees-3.html
@@ -0,0 +1,66 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Binary Trees', onlyNum = 8;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function TreeNode(left,right,item){
+   this.left = left;
+   this.right = right;
+   this.item = item;
+}
+
+TreeNode.prototype.itemCheck = function(){
+   if (this.left==null) return this.item;
+   else return this.item + this.left.itemCheck() - this.right.itemCheck();
+}
+
+function bottomUpTree(item,depth){
+   if (depth>0){
+      return new TreeNode(
+          bottomUpTree(2*item-1, depth-1)
+         ,bottomUpTree(2*item, depth-1)
+         ,item
+      );
+   }
+   else {
+      return new TreeNode(null,null,item);
+   }
+}
+
+startTest("real-binary-trees");
+
+var ret;
+
+for ( var n = 2; n <= 8; n *= 2 ) (function(n){
+	test( "Binary Trees", n, function(){
+		var minDepth = 4;
+		var maxDepth = Math.max(minDepth + 2, n);
+		var stretchDepth = maxDepth + 1;
+		
+		var check = bottomUpTree(0,stretchDepth).itemCheck();
+		
+		var longLivedTree = bottomUpTree(0,maxDepth);
+		for (var depth=minDepth; depth<=maxDepth; depth+=2){
+		   var iterations = 1 << (maxDepth - depth + minDepth);
+		
+		   check = 0;
+		   for (var i=1; i<=iterations; i++){
+			  check += bottomUpTree(i,depth).itemCheck();
+			  check += bottomUpTree(-i,depth).itemCheck();
+		   }
+		}
+		
+		ret = longLivedTree.itemCheck();
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-cube-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-cube-1.html
new file mode 100644
index 00000000000..a00693b9efb
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-cube-1.html
@@ -0,0 +1,344 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Rotate 3D Cube', onlyNum = 20;
+function thisTest() {
+
+// 3D Cube Rotation
+// http://www.speich.net/computer/moztesting/3d.htm
+// Created by Simon Speich
+
+startTest("real-cube");
+
+var Q = new Array();
+var MTrans = new Array();	// transformation matrix
+var MQube = new Array();	// position information of qube
+var I = new Array();			// entity matrix
+var Origin = new Object();
+var Testing = new Object();
+var LoopTimer;
+
+var DisplArea = new Object();
+DisplArea.Width = 300;
+DisplArea.Height = 300;
+
+function DrawLine(From, To) {
+	var x1 = From.V[0];
+	var x2 = To.V[0];
+	var y1 = From.V[1];
+	var y2 = To.V[1];
+	var dx = Math.abs(x2 - x1);
+	var dy = Math.abs(y2 - y1);
+	var x = x1;
+	var y = y1;
+	var IncX1, IncY1;
+	var IncX2, IncY2;	
+	var Den;
+  var Num;
+  var NumAdd;
+	var NumPix;
+
+	if (x2 >= x1) {	IncX1 = 1; IncX2 = 1;	}
+	else { IncX1 = -1; IncX2 = -1; }
+	if (y2 >= y1)	{	IncY1 = 1; IncY2 = 1; }
+	else { IncY1 = -1; IncY2 = -1; }
+	if (dx >= dy) {
+		IncX1 = 0;
+  	IncY2 = 0;
+  	Den = dx;
+  	Num = dx / 2;
+  	NumAdd = dy;
+		NumPix = dx;
+	}
+	else {
+		IncX2 = 0;
+	  IncY1 = 0;
+  	Den = dy;
+  	Num = dy / 2;
+  	NumAdd = dx;
+  	NumPix = dy;
+	}
+
+	NumPix = Math.round(Q.LastPx + NumPix);
+
+	var i = Q.LastPx;
+	for (; i < NumPix; i++) {
+		Num += NumAdd;
+	  if (Num >= Den) {
+    	Num -= Den;
+    	x += IncX1;
+    	y += IncY1;
+	  }
+  	x += IncX2;
+  	y += IncY2;
+	}
+	Q.LastPx = NumPix;
+}
+
+function CalcCross(V0, V1) {
+	var Cross = new Array();
+	Cross[0] = V0[1]*V1[2] - V0[2]*V1[1];
+	Cross[1] = V0[2]*V1[0] - V0[0]*V1[2];
+	Cross[2] = V0[0]*V1[1] - V0[1]*V1[0];
+	return Cross;
+}
+
+function CalcNormal(V0, V1, V2) {
+	var A = new Array(); 	var B = new Array(); 
+	for (var i = 0; i < 3; i++) {
+		A[i] = V0[i] - V1[i];
+		B[i] = V2[i] - V1[i];
+	}
+	A = CalcCross(A, B);
+	var Length = Math.sqrt(A[0]*A[0] + A[1]*A[1] + A[2]*A[2]); 
+	for (var i = 0; i < 3; i++) A[i] = A[i] / Length;
+	A[3] = 1;
+	return A;
+}
+
+function CreateP(X,Y,Z) {
+	this.V = [X,Y,Z,1];
+}
+
+// mulitplies two matrices
+function MMulti(M1, M2) {
+	var M = [[],[],[],[]];
+	var i = 0;
+	var j = 0;
+	for (; i < 4; i++) {
+		j = 0;
+		for (; j < 4; j++) M[i][j] = M1[i][0] * M2[0][j] + M1[i][1] * M2[1][j] + M1[i][2] * M2[2][j] + M1[i][3] * M2[3][j];
+	}
+	return M;
+}
+
+//multiplies matrix with vector
+function VMulti(M, V) {
+	var Vect = new Array();
+	var i = 0;
+	for (;i < 4; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2] + M[i][3] * V[3];
+	return Vect;
+}
+
+function VMulti2(M, V) {
+	var Vect = new Array();
+	var i = 0;
+	for (;i < 3; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2];
+	return Vect;
+}
+
+// add to matrices
+function MAdd(M1, M2) {
+	var M = [[],[],[],[]];
+	var i = 0;
+	var j = 0;
+	for (; i < 4; i++) {
+		j = 0;
+		for (; j < 4; j++) M[i][j] = M1[i][j] + M2[i][j];
+	}
+	return M;
+}
+
+function Translate(M, Dx, Dy, Dz) {
+	var T = [
+	[1,0,0,Dx],
+	[0,1,0,Dy],
+	[0,0,1,Dz],
+	[0,0,0,1]
+	];
+	return MMulti(T, M);
+}
+
+function RotateX(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[1,0,0,0],
+	[0,Cos,-Sin,0],
+	[0,Sin,Cos,0],
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function RotateY(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[Cos,0,Sin,0],
+	[0,1,0,0],
+	[-Sin,0,Cos,0],
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function RotateZ(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[Cos,-Sin,0,0],
+	[Sin,Cos,0,0],
+	[0,0,1,0],   
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function DrawQube() {
+	// calc current normals
+	var CurN = new Array();
+	var i = 5;
+	Q.LastPx = 0;
+	for (; i > -1; i--) CurN[i] = VMulti2(MQube, Q.Normal[i]);
+	if (CurN[0][2] < 0) {
+		if (!Q.Line[0]) { DrawLine(Q[0], Q[1]); Q.Line[0] = true; };
+		if (!Q.Line[1]) { DrawLine(Q[1], Q[2]); Q.Line[1] = true; };
+		if (!Q.Line[2]) { DrawLine(Q[2], Q[3]); Q.Line[2] = true; };
+		if (!Q.Line[3]) { DrawLine(Q[3], Q[0]); Q.Line[3] = true; };
+	}
+	if (CurN[1][2] < 0) {
+		if (!Q.Line[2]) { DrawLine(Q[3], Q[2]); Q.Line[2] = true; };
+		if (!Q.Line[9]) { DrawLine(Q[2], Q[6]); Q.Line[9] = true; };
+		if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
+		if (!Q.Line[10]) { DrawLine(Q[7], Q[3]); Q.Line[10] = true; };
+	}
+	if (CurN[2][2] < 0) {
+		if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
+		if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
+		if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
+		if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
+	}
+	if (CurN[3][2] < 0) {
+		if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
+		if (!Q.Line[8]) { DrawLine(Q[5], Q[1]); Q.Line[8] = true; };
+		if (!Q.Line[0]) { DrawLine(Q[1], Q[0]); Q.Line[0] = true; };
+		if (!Q.Line[11]) { DrawLine(Q[0], Q[4]); Q.Line[11] = true; };
+	}
+	if (CurN[4][2] < 0) {
+		if (!Q.Line[11]) { DrawLine(Q[4], Q[0]); Q.Line[11] = true; };
+		if (!Q.Line[3]) { DrawLine(Q[0], Q[3]); Q.Line[3] = true; };
+		if (!Q.Line[10]) { DrawLine(Q[3], Q[7]); Q.Line[10] = true; };
+		if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
+	}
+	if (CurN[5][2] < 0) {
+		if (!Q.Line[8]) { DrawLine(Q[1], Q[5]); Q.Line[8] = true; };
+		if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
+		if (!Q.Line[9]) { DrawLine(Q[6], Q[2]); Q.Line[9] = true; };
+		if (!Q.Line[1]) { DrawLine(Q[2], Q[1]); Q.Line[1] = true; };
+	}
+	Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
+	Q.LastPx = 0;
+}
+
+function Loop() {
+	if (Testing.LoopCount > Testing.LoopMax) return;
+	var TestingStr = String(Testing.LoopCount);
+	while (TestingStr.length < 3) TestingStr = "0" + TestingStr;
+	MTrans = Translate(I, -Q[8].V[0], -Q[8].V[1], -Q[8].V[2]);
+	MTrans = RotateX(MTrans, 1);
+	MTrans = RotateY(MTrans, 3);
+	MTrans = RotateZ(MTrans, 5);
+	MTrans = Translate(MTrans, Q[8].V[0], Q[8].V[1], Q[8].V[2]);
+	MQube = MMulti(MTrans, MQube);
+	var i = 8;
+	for (; i > -1; i--) {
+		Q[i].V = VMulti(MTrans, Q[i].V);
+	}
+	DrawQube();
+	Testing.LoopCount++;
+	Loop();
+}
+
+function Init(CubeSize) {
+	// init/reset vars
+	Origin.V = [150,150,20,1];
+	Testing.LoopCount = 0;
+	Testing.LoopMax = 50;
+	Testing.TimeMax = 0;
+	Testing.TimeAvg = 0;
+	Testing.TimeMin = 0;
+	Testing.TimeTemp = 0;
+	Testing.TimeTotal = 0;
+	Testing.Init = false;
+
+	// transformation matrix
+	MTrans = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// position information of qube
+	MQube = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// entity matrix
+	I = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// create qube
+	Q[0] = new CreateP(-CubeSize,-CubeSize, CubeSize);
+	Q[1] = new CreateP(-CubeSize, CubeSize, CubeSize);
+	Q[2] = new CreateP( CubeSize, CubeSize, CubeSize);
+	Q[3] = new CreateP( CubeSize,-CubeSize, CubeSize);
+	Q[4] = new CreateP(-CubeSize,-CubeSize,-CubeSize);
+	Q[5] = new CreateP(-CubeSize, CubeSize,-CubeSize);
+	Q[6] = new CreateP( CubeSize, CubeSize,-CubeSize);
+	Q[7] = new CreateP( CubeSize,-CubeSize,-CubeSize);
+	
+	// center of gravity
+	Q[8] = new CreateP(0, 0, 0);
+	
+	// anti-clockwise edge check
+	Q.Edge = [[0,1,2],[3,2,6],[7,6,5],[4,5,1],[4,0,3],[1,5,6]];
+	
+	// calculate squad normals
+	Q.Normal = new Array();
+	for (var i = 0; i < Q.Edge.length; i++) Q.Normal[i] = CalcNormal(Q[Q.Edge[i][0]].V, Q[Q.Edge[i][1]].V, Q[Q.Edge[i][2]].V);
+	
+	// line drawn ?
+	Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
+	
+	// create line pixels
+	Q.NumPx = 9 * 2 * CubeSize;
+	for (var i = 0; i < Q.NumPx; i++) CreateP(0,0,0);
+	
+	MTrans = Translate(MTrans, Origin.V[0], Origin.V[1], Origin.V[2]);
+	MQube = MMulti(MTrans, MQube);
+
+	var i = 0;
+	for (; i < 9; i++) {
+		Q[i].V = VMulti(MTrans, Q[i].V);
+	}
+	DrawQube();
+	Testing.Init = true;
+	Loop();
+}
+
+for ( var i = 20; i <= 160; i *= 2 ) (function(i){
+	test("Rotate 3D Cube", i, function(){
+		Init(i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-cube-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-cube-2.html
new file mode 100644
index 00000000000..e81b27850cc
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-cube-2.html
@@ -0,0 +1,344 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Rotate 3D Cube', onlyNum = 40;
+function thisTest() {
+
+// 3D Cube Rotation
+// http://www.speich.net/computer/moztesting/3d.htm
+// Created by Simon Speich
+
+startTest("real-cube");
+
+var Q = new Array();
+var MTrans = new Array();	// transformation matrix
+var MQube = new Array();	// position information of qube
+var I = new Array();			// entity matrix
+var Origin = new Object();
+var Testing = new Object();
+var LoopTimer;
+
+var DisplArea = new Object();
+DisplArea.Width = 300;
+DisplArea.Height = 300;
+
+function DrawLine(From, To) {
+	var x1 = From.V[0];
+	var x2 = To.V[0];
+	var y1 = From.V[1];
+	var y2 = To.V[1];
+	var dx = Math.abs(x2 - x1);
+	var dy = Math.abs(y2 - y1);
+	var x = x1;
+	var y = y1;
+	var IncX1, IncY1;
+	var IncX2, IncY2;	
+	var Den;
+  var Num;
+  var NumAdd;
+	var NumPix;
+
+	if (x2 >= x1) {	IncX1 = 1; IncX2 = 1;	}
+	else { IncX1 = -1; IncX2 = -1; }
+	if (y2 >= y1)	{	IncY1 = 1; IncY2 = 1; }
+	else { IncY1 = -1; IncY2 = -1; }
+	if (dx >= dy) {
+		IncX1 = 0;
+  	IncY2 = 0;
+  	Den = dx;
+  	Num = dx / 2;
+  	NumAdd = dy;
+		NumPix = dx;
+	}
+	else {
+		IncX2 = 0;
+	  IncY1 = 0;
+  	Den = dy;
+  	Num = dy / 2;
+  	NumAdd = dx;
+  	NumPix = dy;
+	}
+
+	NumPix = Math.round(Q.LastPx + NumPix);
+
+	var i = Q.LastPx;
+	for (; i < NumPix; i++) {
+		Num += NumAdd;
+	  if (Num >= Den) {
+    	Num -= Den;
+    	x += IncX1;
+    	y += IncY1;
+	  }
+  	x += IncX2;
+  	y += IncY2;
+	}
+	Q.LastPx = NumPix;
+}
+
+function CalcCross(V0, V1) {
+	var Cross = new Array();
+	Cross[0] = V0[1]*V1[2] - V0[2]*V1[1];
+	Cross[1] = V0[2]*V1[0] - V0[0]*V1[2];
+	Cross[2] = V0[0]*V1[1] - V0[1]*V1[0];
+	return Cross;
+}
+
+function CalcNormal(V0, V1, V2) {
+	var A = new Array(); 	var B = new Array(); 
+	for (var i = 0; i < 3; i++) {
+		A[i] = V0[i] - V1[i];
+		B[i] = V2[i] - V1[i];
+	}
+	A = CalcCross(A, B);
+	var Length = Math.sqrt(A[0]*A[0] + A[1]*A[1] + A[2]*A[2]); 
+	for (var i = 0; i < 3; i++) A[i] = A[i] / Length;
+	A[3] = 1;
+	return A;
+}
+
+function CreateP(X,Y,Z) {
+	this.V = [X,Y,Z,1];
+}
+
+// mulitplies two matrices
+function MMulti(M1, M2) {
+	var M = [[],[],[],[]];
+	var i = 0;
+	var j = 0;
+	for (; i < 4; i++) {
+		j = 0;
+		for (; j < 4; j++) M[i][j] = M1[i][0] * M2[0][j] + M1[i][1] * M2[1][j] + M1[i][2] * M2[2][j] + M1[i][3] * M2[3][j];
+	}
+	return M;
+}
+
+//multiplies matrix with vector
+function VMulti(M, V) {
+	var Vect = new Array();
+	var i = 0;
+	for (;i < 4; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2] + M[i][3] * V[3];
+	return Vect;
+}
+
+function VMulti2(M, V) {
+	var Vect = new Array();
+	var i = 0;
+	for (;i < 3; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2];
+	return Vect;
+}
+
+// add to matrices
+function MAdd(M1, M2) {
+	var M = [[],[],[],[]];
+	var i = 0;
+	var j = 0;
+	for (; i < 4; i++) {
+		j = 0;
+		for (; j < 4; j++) M[i][j] = M1[i][j] + M2[i][j];
+	}
+	return M;
+}
+
+function Translate(M, Dx, Dy, Dz) {
+	var T = [
+	[1,0,0,Dx],
+	[0,1,0,Dy],
+	[0,0,1,Dz],
+	[0,0,0,1]
+	];
+	return MMulti(T, M);
+}
+
+function RotateX(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[1,0,0,0],
+	[0,Cos,-Sin,0],
+	[0,Sin,Cos,0],
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function RotateY(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[Cos,0,Sin,0],
+	[0,1,0,0],
+	[-Sin,0,Cos,0],
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function RotateZ(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[Cos,-Sin,0,0],
+	[Sin,Cos,0,0],
+	[0,0,1,0],   
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function DrawQube() {
+	// calc current normals
+	var CurN = new Array();
+	var i = 5;
+	Q.LastPx = 0;
+	for (; i > -1; i--) CurN[i] = VMulti2(MQube, Q.Normal[i]);
+	if (CurN[0][2] < 0) {
+		if (!Q.Line[0]) { DrawLine(Q[0], Q[1]); Q.Line[0] = true; };
+		if (!Q.Line[1]) { DrawLine(Q[1], Q[2]); Q.Line[1] = true; };
+		if (!Q.Line[2]) { DrawLine(Q[2], Q[3]); Q.Line[2] = true; };
+		if (!Q.Line[3]) { DrawLine(Q[3], Q[0]); Q.Line[3] = true; };
+	}
+	if (CurN[1][2] < 0) {
+		if (!Q.Line[2]) { DrawLine(Q[3], Q[2]); Q.Line[2] = true; };
+		if (!Q.Line[9]) { DrawLine(Q[2], Q[6]); Q.Line[9] = true; };
+		if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
+		if (!Q.Line[10]) { DrawLine(Q[7], Q[3]); Q.Line[10] = true; };
+	}
+	if (CurN[2][2] < 0) {
+		if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
+		if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
+		if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
+		if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
+	}
+	if (CurN[3][2] < 0) {
+		if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
+		if (!Q.Line[8]) { DrawLine(Q[5], Q[1]); Q.Line[8] = true; };
+		if (!Q.Line[0]) { DrawLine(Q[1], Q[0]); Q.Line[0] = true; };
+		if (!Q.Line[11]) { DrawLine(Q[0], Q[4]); Q.Line[11] = true; };
+	}
+	if (CurN[4][2] < 0) {
+		if (!Q.Line[11]) { DrawLine(Q[4], Q[0]); Q.Line[11] = true; };
+		if (!Q.Line[3]) { DrawLine(Q[0], Q[3]); Q.Line[3] = true; };
+		if (!Q.Line[10]) { DrawLine(Q[3], Q[7]); Q.Line[10] = true; };
+		if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
+	}
+	if (CurN[5][2] < 0) {
+		if (!Q.Line[8]) { DrawLine(Q[1], Q[5]); Q.Line[8] = true; };
+		if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
+		if (!Q.Line[9]) { DrawLine(Q[6], Q[2]); Q.Line[9] = true; };
+		if (!Q.Line[1]) { DrawLine(Q[2], Q[1]); Q.Line[1] = true; };
+	}
+	Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
+	Q.LastPx = 0;
+}
+
+function Loop() {
+	if (Testing.LoopCount > Testing.LoopMax) return;
+	var TestingStr = String(Testing.LoopCount);
+	while (TestingStr.length < 3) TestingStr = "0" + TestingStr;
+	MTrans = Translate(I, -Q[8].V[0], -Q[8].V[1], -Q[8].V[2]);
+	MTrans = RotateX(MTrans, 1);
+	MTrans = RotateY(MTrans, 3);
+	MTrans = RotateZ(MTrans, 5);
+	MTrans = Translate(MTrans, Q[8].V[0], Q[8].V[1], Q[8].V[2]);
+	MQube = MMulti(MTrans, MQube);
+	var i = 8;
+	for (; i > -1; i--) {
+		Q[i].V = VMulti(MTrans, Q[i].V);
+	}
+	DrawQube();
+	Testing.LoopCount++;
+	Loop();
+}
+
+function Init(CubeSize) {
+	// init/reset vars
+	Origin.V = [150,150,20,1];
+	Testing.LoopCount = 0;
+	Testing.LoopMax = 50;
+	Testing.TimeMax = 0;
+	Testing.TimeAvg = 0;
+	Testing.TimeMin = 0;
+	Testing.TimeTemp = 0;
+	Testing.TimeTotal = 0;
+	Testing.Init = false;
+
+	// transformation matrix
+	MTrans = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// position information of qube
+	MQube = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// entity matrix
+	I = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// create qube
+	Q[0] = new CreateP(-CubeSize,-CubeSize, CubeSize);
+	Q[1] = new CreateP(-CubeSize, CubeSize, CubeSize);
+	Q[2] = new CreateP( CubeSize, CubeSize, CubeSize);
+	Q[3] = new CreateP( CubeSize,-CubeSize, CubeSize);
+	Q[4] = new CreateP(-CubeSize,-CubeSize,-CubeSize);
+	Q[5] = new CreateP(-CubeSize, CubeSize,-CubeSize);
+	Q[6] = new CreateP( CubeSize, CubeSize,-CubeSize);
+	Q[7] = new CreateP( CubeSize,-CubeSize,-CubeSize);
+	
+	// center of gravity
+	Q[8] = new CreateP(0, 0, 0);
+	
+	// anti-clockwise edge check
+	Q.Edge = [[0,1,2],[3,2,6],[7,6,5],[4,5,1],[4,0,3],[1,5,6]];
+	
+	// calculate squad normals
+	Q.Normal = new Array();
+	for (var i = 0; i < Q.Edge.length; i++) Q.Normal[i] = CalcNormal(Q[Q.Edge[i][0]].V, Q[Q.Edge[i][1]].V, Q[Q.Edge[i][2]].V);
+	
+	// line drawn ?
+	Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
+	
+	// create line pixels
+	Q.NumPx = 9 * 2 * CubeSize;
+	for (var i = 0; i < Q.NumPx; i++) CreateP(0,0,0);
+	
+	MTrans = Translate(MTrans, Origin.V[0], Origin.V[1], Origin.V[2]);
+	MQube = MMulti(MTrans, MQube);
+
+	var i = 0;
+	for (; i < 9; i++) {
+		Q[i].V = VMulti(MTrans, Q[i].V);
+	}
+	DrawQube();
+	Testing.Init = true;
+	Loop();
+}
+
+for ( var i = 20; i <= 160; i *= 2 ) (function(i){
+	test("Rotate 3D Cube", i, function(){
+		Init(i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-cube-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-cube-3.html
new file mode 100644
index 00000000000..8f3bf8ca3c7
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-cube-3.html
@@ -0,0 +1,344 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Rotate 3D Cube', onlyNum = 80;
+function thisTest() {
+
+// 3D Cube Rotation
+// http://www.speich.net/computer/moztesting/3d.htm
+// Created by Simon Speich
+
+startTest("real-cube");
+
+var Q = new Array();
+var MTrans = new Array();	// transformation matrix
+var MQube = new Array();	// position information of qube
+var I = new Array();			// entity matrix
+var Origin = new Object();
+var Testing = new Object();
+var LoopTimer;
+
+var DisplArea = new Object();
+DisplArea.Width = 300;
+DisplArea.Height = 300;
+
+function DrawLine(From, To) {
+	var x1 = From.V[0];
+	var x2 = To.V[0];
+	var y1 = From.V[1];
+	var y2 = To.V[1];
+	var dx = Math.abs(x2 - x1);
+	var dy = Math.abs(y2 - y1);
+	var x = x1;
+	var y = y1;
+	var IncX1, IncY1;
+	var IncX2, IncY2;	
+	var Den;
+  var Num;
+  var NumAdd;
+	var NumPix;
+
+	if (x2 >= x1) {	IncX1 = 1; IncX2 = 1;	}
+	else { IncX1 = -1; IncX2 = -1; }
+	if (y2 >= y1)	{	IncY1 = 1; IncY2 = 1; }
+	else { IncY1 = -1; IncY2 = -1; }
+	if (dx >= dy) {
+		IncX1 = 0;
+  	IncY2 = 0;
+  	Den = dx;
+  	Num = dx / 2;
+  	NumAdd = dy;
+		NumPix = dx;
+	}
+	else {
+		IncX2 = 0;
+	  IncY1 = 0;
+  	Den = dy;
+  	Num = dy / 2;
+  	NumAdd = dx;
+  	NumPix = dy;
+	}
+
+	NumPix = Math.round(Q.LastPx + NumPix);
+
+	var i = Q.LastPx;
+	for (; i < NumPix; i++) {
+		Num += NumAdd;
+	  if (Num >= Den) {
+    	Num -= Den;
+    	x += IncX1;
+    	y += IncY1;
+	  }
+  	x += IncX2;
+  	y += IncY2;
+	}
+	Q.LastPx = NumPix;
+}
+
+function CalcCross(V0, V1) {
+	var Cross = new Array();
+	Cross[0] = V0[1]*V1[2] - V0[2]*V1[1];
+	Cross[1] = V0[2]*V1[0] - V0[0]*V1[2];
+	Cross[2] = V0[0]*V1[1] - V0[1]*V1[0];
+	return Cross;
+}
+
+function CalcNormal(V0, V1, V2) {
+	var A = new Array(); 	var B = new Array(); 
+	for (var i = 0; i < 3; i++) {
+		A[i] = V0[i] - V1[i];
+		B[i] = V2[i] - V1[i];
+	}
+	A = CalcCross(A, B);
+	var Length = Math.sqrt(A[0]*A[0] + A[1]*A[1] + A[2]*A[2]); 
+	for (var i = 0; i < 3; i++) A[i] = A[i] / Length;
+	A[3] = 1;
+	return A;
+}
+
+function CreateP(X,Y,Z) {
+	this.V = [X,Y,Z,1];
+}
+
+// mulitplies two matrices
+function MMulti(M1, M2) {
+	var M = [[],[],[],[]];
+	var i = 0;
+	var j = 0;
+	for (; i < 4; i++) {
+		j = 0;
+		for (; j < 4; j++) M[i][j] = M1[i][0] * M2[0][j] + M1[i][1] * M2[1][j] + M1[i][2] * M2[2][j] + M1[i][3] * M2[3][j];
+	}
+	return M;
+}
+
+//multiplies matrix with vector
+function VMulti(M, V) {
+	var Vect = new Array();
+	var i = 0;
+	for (;i < 4; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2] + M[i][3] * V[3];
+	return Vect;
+}
+
+function VMulti2(M, V) {
+	var Vect = new Array();
+	var i = 0;
+	for (;i < 3; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2];
+	return Vect;
+}
+
+// add to matrices
+function MAdd(M1, M2) {
+	var M = [[],[],[],[]];
+	var i = 0;
+	var j = 0;
+	for (; i < 4; i++) {
+		j = 0;
+		for (; j < 4; j++) M[i][j] = M1[i][j] + M2[i][j];
+	}
+	return M;
+}
+
+function Translate(M, Dx, Dy, Dz) {
+	var T = [
+	[1,0,0,Dx],
+	[0,1,0,Dy],
+	[0,0,1,Dz],
+	[0,0,0,1]
+	];
+	return MMulti(T, M);
+}
+
+function RotateX(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[1,0,0,0],
+	[0,Cos,-Sin,0],
+	[0,Sin,Cos,0],
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function RotateY(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[Cos,0,Sin,0],
+	[0,1,0,0],
+	[-Sin,0,Cos,0],
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function RotateZ(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[Cos,-Sin,0,0],
+	[Sin,Cos,0,0],
+	[0,0,1,0],   
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function DrawQube() {
+	// calc current normals
+	var CurN = new Array();
+	var i = 5;
+	Q.LastPx = 0;
+	for (; i > -1; i--) CurN[i] = VMulti2(MQube, Q.Normal[i]);
+	if (CurN[0][2] < 0) {
+		if (!Q.Line[0]) { DrawLine(Q[0], Q[1]); Q.Line[0] = true; };
+		if (!Q.Line[1]) { DrawLine(Q[1], Q[2]); Q.Line[1] = true; };
+		if (!Q.Line[2]) { DrawLine(Q[2], Q[3]); Q.Line[2] = true; };
+		if (!Q.Line[3]) { DrawLine(Q[3], Q[0]); Q.Line[3] = true; };
+	}
+	if (CurN[1][2] < 0) {
+		if (!Q.Line[2]) { DrawLine(Q[3], Q[2]); Q.Line[2] = true; };
+		if (!Q.Line[9]) { DrawLine(Q[2], Q[6]); Q.Line[9] = true; };
+		if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
+		if (!Q.Line[10]) { DrawLine(Q[7], Q[3]); Q.Line[10] = true; };
+	}
+	if (CurN[2][2] < 0) {
+		if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
+		if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
+		if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
+		if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
+	}
+	if (CurN[3][2] < 0) {
+		if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
+		if (!Q.Line[8]) { DrawLine(Q[5], Q[1]); Q.Line[8] = true; };
+		if (!Q.Line[0]) { DrawLine(Q[1], Q[0]); Q.Line[0] = true; };
+		if (!Q.Line[11]) { DrawLine(Q[0], Q[4]); Q.Line[11] = true; };
+	}
+	if (CurN[4][2] < 0) {
+		if (!Q.Line[11]) { DrawLine(Q[4], Q[0]); Q.Line[11] = true; };
+		if (!Q.Line[3]) { DrawLine(Q[0], Q[3]); Q.Line[3] = true; };
+		if (!Q.Line[10]) { DrawLine(Q[3], Q[7]); Q.Line[10] = true; };
+		if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
+	}
+	if (CurN[5][2] < 0) {
+		if (!Q.Line[8]) { DrawLine(Q[1], Q[5]); Q.Line[8] = true; };
+		if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
+		if (!Q.Line[9]) { DrawLine(Q[6], Q[2]); Q.Line[9] = true; };
+		if (!Q.Line[1]) { DrawLine(Q[2], Q[1]); Q.Line[1] = true; };
+	}
+	Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
+	Q.LastPx = 0;
+}
+
+function Loop() {
+	if (Testing.LoopCount > Testing.LoopMax) return;
+	var TestingStr = String(Testing.LoopCount);
+	while (TestingStr.length < 3) TestingStr = "0" + TestingStr;
+	MTrans = Translate(I, -Q[8].V[0], -Q[8].V[1], -Q[8].V[2]);
+	MTrans = RotateX(MTrans, 1);
+	MTrans = RotateY(MTrans, 3);
+	MTrans = RotateZ(MTrans, 5);
+	MTrans = Translate(MTrans, Q[8].V[0], Q[8].V[1], Q[8].V[2]);
+	MQube = MMulti(MTrans, MQube);
+	var i = 8;
+	for (; i > -1; i--) {
+		Q[i].V = VMulti(MTrans, Q[i].V);
+	}
+	DrawQube();
+	Testing.LoopCount++;
+	Loop();
+}
+
+function Init(CubeSize) {
+	// init/reset vars
+	Origin.V = [150,150,20,1];
+	Testing.LoopCount = 0;
+	Testing.LoopMax = 50;
+	Testing.TimeMax = 0;
+	Testing.TimeAvg = 0;
+	Testing.TimeMin = 0;
+	Testing.TimeTemp = 0;
+	Testing.TimeTotal = 0;
+	Testing.Init = false;
+
+	// transformation matrix
+	MTrans = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// position information of qube
+	MQube = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// entity matrix
+	I = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// create qube
+	Q[0] = new CreateP(-CubeSize,-CubeSize, CubeSize);
+	Q[1] = new CreateP(-CubeSize, CubeSize, CubeSize);
+	Q[2] = new CreateP( CubeSize, CubeSize, CubeSize);
+	Q[3] = new CreateP( CubeSize,-CubeSize, CubeSize);
+	Q[4] = new CreateP(-CubeSize,-CubeSize,-CubeSize);
+	Q[5] = new CreateP(-CubeSize, CubeSize,-CubeSize);
+	Q[6] = new CreateP( CubeSize, CubeSize,-CubeSize);
+	Q[7] = new CreateP( CubeSize,-CubeSize,-CubeSize);
+	
+	// center of gravity
+	Q[8] = new CreateP(0, 0, 0);
+	
+	// anti-clockwise edge check
+	Q.Edge = [[0,1,2],[3,2,6],[7,6,5],[4,5,1],[4,0,3],[1,5,6]];
+	
+	// calculate squad normals
+	Q.Normal = new Array();
+	for (var i = 0; i < Q.Edge.length; i++) Q.Normal[i] = CalcNormal(Q[Q.Edge[i][0]].V, Q[Q.Edge[i][1]].V, Q[Q.Edge[i][2]].V);
+	
+	// line drawn ?
+	Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
+	
+	// create line pixels
+	Q.NumPx = 9 * 2 * CubeSize;
+	for (var i = 0; i < Q.NumPx; i++) CreateP(0,0,0);
+	
+	MTrans = Translate(MTrans, Origin.V[0], Origin.V[1], Origin.V[2]);
+	MQube = MMulti(MTrans, MQube);
+
+	var i = 0;
+	for (; i < 9; i++) {
+		Q[i].V = VMulti(MTrans, Q[i].V);
+	}
+	DrawQube();
+	Testing.Init = true;
+	Loop();
+}
+
+for ( var i = 20; i <= 160; i *= 2 ) (function(i){
+	test("Rotate 3D Cube", i, function(){
+		Init(i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-cube-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-cube-4.html
new file mode 100644
index 00000000000..cc84b757ab0
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-cube-4.html
@@ -0,0 +1,344 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Rotate 3D Cube', onlyNum = 160;
+function thisTest() {
+
+// 3D Cube Rotation
+// http://www.speich.net/computer/moztesting/3d.htm
+// Created by Simon Speich
+
+startTest("real-cube");
+
+var Q = new Array();
+var MTrans = new Array();	// transformation matrix
+var MQube = new Array();	// position information of qube
+var I = new Array();			// entity matrix
+var Origin = new Object();
+var Testing = new Object();
+var LoopTimer;
+
+var DisplArea = new Object();
+DisplArea.Width = 300;
+DisplArea.Height = 300;
+
+function DrawLine(From, To) {
+	var x1 = From.V[0];
+	var x2 = To.V[0];
+	var y1 = From.V[1];
+	var y2 = To.V[1];
+	var dx = Math.abs(x2 - x1);
+	var dy = Math.abs(y2 - y1);
+	var x = x1;
+	var y = y1;
+	var IncX1, IncY1;
+	var IncX2, IncY2;	
+	var Den;
+  var Num;
+  var NumAdd;
+	var NumPix;
+
+	if (x2 >= x1) {	IncX1 = 1; IncX2 = 1;	}
+	else { IncX1 = -1; IncX2 = -1; }
+	if (y2 >= y1)	{	IncY1 = 1; IncY2 = 1; }
+	else { IncY1 = -1; IncY2 = -1; }
+	if (dx >= dy) {
+		IncX1 = 0;
+  	IncY2 = 0;
+  	Den = dx;
+  	Num = dx / 2;
+  	NumAdd = dy;
+		NumPix = dx;
+	}
+	else {
+		IncX2 = 0;
+	  IncY1 = 0;
+  	Den = dy;
+  	Num = dy / 2;
+  	NumAdd = dx;
+  	NumPix = dy;
+	}
+
+	NumPix = Math.round(Q.LastPx + NumPix);
+
+	var i = Q.LastPx;
+	for (; i < NumPix; i++) {
+		Num += NumAdd;
+	  if (Num >= Den) {
+    	Num -= Den;
+    	x += IncX1;
+    	y += IncY1;
+	  }
+  	x += IncX2;
+  	y += IncY2;
+	}
+	Q.LastPx = NumPix;
+}
+
+function CalcCross(V0, V1) {
+	var Cross = new Array();
+	Cross[0] = V0[1]*V1[2] - V0[2]*V1[1];
+	Cross[1] = V0[2]*V1[0] - V0[0]*V1[2];
+	Cross[2] = V0[0]*V1[1] - V0[1]*V1[0];
+	return Cross;
+}
+
+function CalcNormal(V0, V1, V2) {
+	var A = new Array(); 	var B = new Array(); 
+	for (var i = 0; i < 3; i++) {
+		A[i] = V0[i] - V1[i];
+		B[i] = V2[i] - V1[i];
+	}
+	A = CalcCross(A, B);
+	var Length = Math.sqrt(A[0]*A[0] + A[1]*A[1] + A[2]*A[2]); 
+	for (var i = 0; i < 3; i++) A[i] = A[i] / Length;
+	A[3] = 1;
+	return A;
+}
+
+function CreateP(X,Y,Z) {
+	this.V = [X,Y,Z,1];
+}
+
+// mulitplies two matrices
+function MMulti(M1, M2) {
+	var M = [[],[],[],[]];
+	var i = 0;
+	var j = 0;
+	for (; i < 4; i++) {
+		j = 0;
+		for (; j < 4; j++) M[i][j] = M1[i][0] * M2[0][j] + M1[i][1] * M2[1][j] + M1[i][2] * M2[2][j] + M1[i][3] * M2[3][j];
+	}
+	return M;
+}
+
+//multiplies matrix with vector
+function VMulti(M, V) {
+	var Vect = new Array();
+	var i = 0;
+	for (;i < 4; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2] + M[i][3] * V[3];
+	return Vect;
+}
+
+function VMulti2(M, V) {
+	var Vect = new Array();
+	var i = 0;
+	for (;i < 3; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2];
+	return Vect;
+}
+
+// add to matrices
+function MAdd(M1, M2) {
+	var M = [[],[],[],[]];
+	var i = 0;
+	var j = 0;
+	for (; i < 4; i++) {
+		j = 0;
+		for (; j < 4; j++) M[i][j] = M1[i][j] + M2[i][j];
+	}
+	return M;
+}
+
+function Translate(M, Dx, Dy, Dz) {
+	var T = [
+	[1,0,0,Dx],
+	[0,1,0,Dy],
+	[0,0,1,Dz],
+	[0,0,0,1]
+	];
+	return MMulti(T, M);
+}
+
+function RotateX(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[1,0,0,0],
+	[0,Cos,-Sin,0],
+	[0,Sin,Cos,0],
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function RotateY(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[Cos,0,Sin,0],
+	[0,1,0,0],
+	[-Sin,0,Cos,0],
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function RotateZ(M, Phi) {
+	var a = Phi;
+	a *= Math.PI / 180;
+	var Cos = Math.cos(a);
+	var Sin = Math.sin(a);
+	var R = [
+	[Cos,-Sin,0,0],
+	[Sin,Cos,0,0],
+	[0,0,1,0],   
+	[0,0,0,1]
+	];
+	return MMulti(R, M);
+}
+
+function DrawQube() {
+	// calc current normals
+	var CurN = new Array();
+	var i = 5;
+	Q.LastPx = 0;
+	for (; i > -1; i--) CurN[i] = VMulti2(MQube, Q.Normal[i]);
+	if (CurN[0][2] < 0) {
+		if (!Q.Line[0]) { DrawLine(Q[0], Q[1]); Q.Line[0] = true; };
+		if (!Q.Line[1]) { DrawLine(Q[1], Q[2]); Q.Line[1] = true; };
+		if (!Q.Line[2]) { DrawLine(Q[2], Q[3]); Q.Line[2] = true; };
+		if (!Q.Line[3]) { DrawLine(Q[3], Q[0]); Q.Line[3] = true; };
+	}
+	if (CurN[1][2] < 0) {
+		if (!Q.Line[2]) { DrawLine(Q[3], Q[2]); Q.Line[2] = true; };
+		if (!Q.Line[9]) { DrawLine(Q[2], Q[6]); Q.Line[9] = true; };
+		if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
+		if (!Q.Line[10]) { DrawLine(Q[7], Q[3]); Q.Line[10] = true; };
+	}
+	if (CurN[2][2] < 0) {
+		if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
+		if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
+		if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
+		if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
+	}
+	if (CurN[3][2] < 0) {
+		if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
+		if (!Q.Line[8]) { DrawLine(Q[5], Q[1]); Q.Line[8] = true; };
+		if (!Q.Line[0]) { DrawLine(Q[1], Q[0]); Q.Line[0] = true; };
+		if (!Q.Line[11]) { DrawLine(Q[0], Q[4]); Q.Line[11] = true; };
+	}
+	if (CurN[4][2] < 0) {
+		if (!Q.Line[11]) { DrawLine(Q[4], Q[0]); Q.Line[11] = true; };
+		if (!Q.Line[3]) { DrawLine(Q[0], Q[3]); Q.Line[3] = true; };
+		if (!Q.Line[10]) { DrawLine(Q[3], Q[7]); Q.Line[10] = true; };
+		if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
+	}
+	if (CurN[5][2] < 0) {
+		if (!Q.Line[8]) { DrawLine(Q[1], Q[5]); Q.Line[8] = true; };
+		if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
+		if (!Q.Line[9]) { DrawLine(Q[6], Q[2]); Q.Line[9] = true; };
+		if (!Q.Line[1]) { DrawLine(Q[2], Q[1]); Q.Line[1] = true; };
+	}
+	Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
+	Q.LastPx = 0;
+}
+
+function Loop() {
+	if (Testing.LoopCount > Testing.LoopMax) return;
+	var TestingStr = String(Testing.LoopCount);
+	while (TestingStr.length < 3) TestingStr = "0" + TestingStr;
+	MTrans = Translate(I, -Q[8].V[0], -Q[8].V[1], -Q[8].V[2]);
+	MTrans = RotateX(MTrans, 1);
+	MTrans = RotateY(MTrans, 3);
+	MTrans = RotateZ(MTrans, 5);
+	MTrans = Translate(MTrans, Q[8].V[0], Q[8].V[1], Q[8].V[2]);
+	MQube = MMulti(MTrans, MQube);
+	var i = 8;
+	for (; i > -1; i--) {
+		Q[i].V = VMulti(MTrans, Q[i].V);
+	}
+	DrawQube();
+	Testing.LoopCount++;
+	Loop();
+}
+
+function Init(CubeSize) {
+	// init/reset vars
+	Origin.V = [150,150,20,1];
+	Testing.LoopCount = 0;
+	Testing.LoopMax = 50;
+	Testing.TimeMax = 0;
+	Testing.TimeAvg = 0;
+	Testing.TimeMin = 0;
+	Testing.TimeTemp = 0;
+	Testing.TimeTotal = 0;
+	Testing.Init = false;
+
+	// transformation matrix
+	MTrans = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// position information of qube
+	MQube = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// entity matrix
+	I = [
+	[1,0,0,0],
+	[0,1,0,0],
+	[0,0,1,0],
+	[0,0,0,1]
+	];
+	
+	// create qube
+	Q[0] = new CreateP(-CubeSize,-CubeSize, CubeSize);
+	Q[1] = new CreateP(-CubeSize, CubeSize, CubeSize);
+	Q[2] = new CreateP( CubeSize, CubeSize, CubeSize);
+	Q[3] = new CreateP( CubeSize,-CubeSize, CubeSize);
+	Q[4] = new CreateP(-CubeSize,-CubeSize,-CubeSize);
+	Q[5] = new CreateP(-CubeSize, CubeSize,-CubeSize);
+	Q[6] = new CreateP( CubeSize, CubeSize,-CubeSize);
+	Q[7] = new CreateP( CubeSize,-CubeSize,-CubeSize);
+	
+	// center of gravity
+	Q[8] = new CreateP(0, 0, 0);
+	
+	// anti-clockwise edge check
+	Q.Edge = [[0,1,2],[3,2,6],[7,6,5],[4,5,1],[4,0,3],[1,5,6]];
+	
+	// calculate squad normals
+	Q.Normal = new Array();
+	for (var i = 0; i < Q.Edge.length; i++) Q.Normal[i] = CalcNormal(Q[Q.Edge[i][0]].V, Q[Q.Edge[i][1]].V, Q[Q.Edge[i][2]].V);
+	
+	// line drawn ?
+	Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
+	
+	// create line pixels
+	Q.NumPx = 9 * 2 * CubeSize;
+	for (var i = 0; i < Q.NumPx; i++) CreateP(0,0,0);
+	
+	MTrans = Translate(MTrans, Origin.V[0], Origin.V[1], Origin.V[2]);
+	MQube = MMulti(MTrans, MQube);
+
+	var i = 0;
+	for (; i < 9; i++) {
+		Q[i].V = VMulti(MTrans, Q[i].V);
+	}
+	DrawQube();
+	Testing.Init = true;
+	Loop();
+}
+
+for ( var i = 20; i <= 160; i *= 2 ) (function(i){
+	test("Rotate 3D Cube", i, function(){
+		Init(i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-1.html
new file mode 100644
index 00000000000..859ddebe66c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-1.html
@@ -0,0 +1,84 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Pfannkuchen', onlyNum = 5;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function fannkuch(n) {
+   var check = 0;
+   var perm = Array(n);
+   var perm1 = Array(n);
+   var count = Array(n);
+   var maxPerm = Array(n);
+   var maxFlipsCount = 0;
+   var m = n - 1;
+
+   for (var i = 0; i < n; i++) perm1[i] = i;
+   var r = n;
+
+   while (true) {
+      // write-out the first 30 permutations
+      if (check < 30){
+         var s = "";
+         for(var i=0; i<n; i++) s += (perm1[i]+1).toString();
+         check++;
+      }
+
+      while (r != 1) { count[r - 1] = r; r--; }
+      if (!(perm1[0] == 0 || perm1[m] == m)) {
+         for (var i = 0; i < n; i++) perm[i] = perm1[i];
+
+         var flipsCount = 0;
+         var k;
+
+         while (!((k = perm[0]) == 0)) {
+            var k2 = (k + 1) >> 1;
+            for (var i = 0; i < k2; i++) {
+               var temp = perm[i]; perm[i] = perm[k - i]; perm[k - i] = temp;
+            }
+            flipsCount++;
+         }
+
+         if (flipsCount > maxFlipsCount) {
+            maxFlipsCount = flipsCount;
+            for (var i = 0; i < n; i++) maxPerm[i] = perm1[i];
+         }
+      }
+
+      while (true) {
+         if (r == n) return maxFlipsCount;
+         var perm0 = perm1[0];
+         var i = 0;
+         while (i < r) {
+            var j = i + 1;
+            perm1[i] = perm1[j];
+            i = j;
+         }
+         perm1[r] = perm0;
+
+         count[r] = count[r] - 1;
+         if (count[r] > 0) break;
+         r++;
+      }
+   }
+}
+
+startTest("real-fannkuch");
+
+var ret;
+
+for ( var n = 5; n <= 8; n++ ) (function(n){
+	test( "Pfannkuchen", n, function(){
+		ret = fannkuch(n);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-2.html
new file mode 100644
index 00000000000..77deb91fc59
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-2.html
@@ -0,0 +1,84 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Pfannkuchen', onlyNum = 6;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function fannkuch(n) {
+   var check = 0;
+   var perm = Array(n);
+   var perm1 = Array(n);
+   var count = Array(n);
+   var maxPerm = Array(n);
+   var maxFlipsCount = 0;
+   var m = n - 1;
+
+   for (var i = 0; i < n; i++) perm1[i] = i;
+   var r = n;
+
+   while (true) {
+      // write-out the first 30 permutations
+      if (check < 30){
+         var s = "";
+         for(var i=0; i<n; i++) s += (perm1[i]+1).toString();
+         check++;
+      }
+
+      while (r != 1) { count[r - 1] = r; r--; }
+      if (!(perm1[0] == 0 || perm1[m] == m)) {
+         for (var i = 0; i < n; i++) perm[i] = perm1[i];
+
+         var flipsCount = 0;
+         var k;
+
+         while (!((k = perm[0]) == 0)) {
+            var k2 = (k + 1) >> 1;
+            for (var i = 0; i < k2; i++) {
+               var temp = perm[i]; perm[i] = perm[k - i]; perm[k - i] = temp;
+            }
+            flipsCount++;
+         }
+
+         if (flipsCount > maxFlipsCount) {
+            maxFlipsCount = flipsCount;
+            for (var i = 0; i < n; i++) maxPerm[i] = perm1[i];
+         }
+      }
+
+      while (true) {
+         if (r == n) return maxFlipsCount;
+         var perm0 = perm1[0];
+         var i = 0;
+         while (i < r) {
+            var j = i + 1;
+            perm1[i] = perm1[j];
+            i = j;
+         }
+         perm1[r] = perm0;
+
+         count[r] = count[r] - 1;
+         if (count[r] > 0) break;
+         r++;
+      }
+   }
+}
+
+startTest("real-fannkuch");
+
+var ret;
+
+for ( var n = 5; n <= 8; n++ ) (function(n){
+	test( "Pfannkuchen", n, function(){
+		ret = fannkuch(n);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-3.html
new file mode 100644
index 00000000000..02ae920b4ed
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-3.html
@@ -0,0 +1,84 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Pfannkuchen', onlyNum = 7;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function fannkuch(n) {
+   var check = 0;
+   var perm = Array(n);
+   var perm1 = Array(n);
+   var count = Array(n);
+   var maxPerm = Array(n);
+   var maxFlipsCount = 0;
+   var m = n - 1;
+
+   for (var i = 0; i < n; i++) perm1[i] = i;
+   var r = n;
+
+   while (true) {
+      // write-out the first 30 permutations
+      if (check < 30){
+         var s = "";
+         for(var i=0; i<n; i++) s += (perm1[i]+1).toString();
+         check++;
+      }
+
+      while (r != 1) { count[r - 1] = r; r--; }
+      if (!(perm1[0] == 0 || perm1[m] == m)) {
+         for (var i = 0; i < n; i++) perm[i] = perm1[i];
+
+         var flipsCount = 0;
+         var k;
+
+         while (!((k = perm[0]) == 0)) {
+            var k2 = (k + 1) >> 1;
+            for (var i = 0; i < k2; i++) {
+               var temp = perm[i]; perm[i] = perm[k - i]; perm[k - i] = temp;
+            }
+            flipsCount++;
+         }
+
+         if (flipsCount > maxFlipsCount) {
+            maxFlipsCount = flipsCount;
+            for (var i = 0; i < n; i++) maxPerm[i] = perm1[i];
+         }
+      }
+
+      while (true) {
+         if (r == n) return maxFlipsCount;
+         var perm0 = perm1[0];
+         var i = 0;
+         while (i < r) {
+            var j = i + 1;
+            perm1[i] = perm1[j];
+            i = j;
+         }
+         perm1[r] = perm0;
+
+         count[r] = count[r] - 1;
+         if (count[r] > 0) break;
+         r++;
+      }
+   }
+}
+
+startTest("real-fannkuch");
+
+var ret;
+
+for ( var n = 5; n <= 8; n++ ) (function(n){
+	test( "Pfannkuchen", n, function(){
+		ret = fannkuch(n);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-4.html
new file mode 100644
index 00000000000..0de252c3395
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fannkuch-4.html
@@ -0,0 +1,84 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Pfannkuchen', onlyNum = 8;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function fannkuch(n) {
+   var check = 0;
+   var perm = Array(n);
+   var perm1 = Array(n);
+   var count = Array(n);
+   var maxPerm = Array(n);
+   var maxFlipsCount = 0;
+   var m = n - 1;
+
+   for (var i = 0; i < n; i++) perm1[i] = i;
+   var r = n;
+
+   while (true) {
+      // write-out the first 30 permutations
+      if (check < 30){
+         var s = "";
+         for(var i=0; i<n; i++) s += (perm1[i]+1).toString();
+         check++;
+      }
+
+      while (r != 1) { count[r - 1] = r; r--; }
+      if (!(perm1[0] == 0 || perm1[m] == m)) {
+         for (var i = 0; i < n; i++) perm[i] = perm1[i];
+
+         var flipsCount = 0;
+         var k;
+
+         while (!((k = perm[0]) == 0)) {
+            var k2 = (k + 1) >> 1;
+            for (var i = 0; i < k2; i++) {
+               var temp = perm[i]; perm[i] = perm[k - i]; perm[k - i] = temp;
+            }
+            flipsCount++;
+         }
+
+         if (flipsCount > maxFlipsCount) {
+            maxFlipsCount = flipsCount;
+            for (var i = 0; i < n; i++) maxPerm[i] = perm1[i];
+         }
+      }
+
+      while (true) {
+         if (r == n) return maxFlipsCount;
+         var perm0 = perm1[0];
+         var i = 0;
+         while (i < r) {
+            var j = i + 1;
+            perm1[i] = perm1[j];
+            i = j;
+         }
+         perm1[r] = perm0;
+
+         count[r] = count[r] - 1;
+         if (count[r] > 0) break;
+         r++;
+      }
+   }
+}
+
+startTest("real-fannkuch");
+
+var ret;
+
+for ( var n = 5; n <= 8; n++ ) (function(n){
+	test( "Pfannkuchen", n, function(){
+		ret = fannkuch(n);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-1.html
new file mode 100644
index 00000000000..4bdc51ecbbd
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-1.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Homo sapiens alu', onlyNum = 2;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-10.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-10.html
new file mode 100644
index 00000000000..91f56e8a8d4
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-10.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Homo sapiens alu', onlyNum = 16;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-11.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-11.html
new file mode 100644
index 00000000000..b8f0167c4e6
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-11.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'IUB ambiguity codes', onlyNum = 16;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-12.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-12.html
new file mode 100644
index 00000000000..c443423d147
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-12.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Homo sapiens frequenc', onlyNum = 16;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-2.html
new file mode 100644
index 00000000000..78414e6253f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-2.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'IUB ambiguity codes', onlyNum = 2;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-3.html
new file mode 100644
index 00000000000..225b713830c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-3.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Homo sapiens frequenc', onlyNum = 2;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-4.html
new file mode 100644
index 00000000000..e164ac3957b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-4.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Homo sapiens alu', onlyNum = 4;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-5.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-5.html
new file mode 100644
index 00000000000..8ed3130de2f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-5.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'IUB ambiguity codes', onlyNum = 4;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-6.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-6.html
new file mode 100644
index 00000000000..987dbaf93a8
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-6.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Homo sapiens frequenc', onlyNum = 4;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-7.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-7.html
new file mode 100644
index 00000000000..cb450f1ef23
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-7.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Homo sapiens alu', onlyNum = 8;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-8.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-8.html
new file mode 100644
index 00000000000..998d1debb7d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-8.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'IUB ambiguity codes', onlyNum = 8;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-9.html b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-9.html
new file mode 100644
index 00000000000..b86b8f33378
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-fasta-9.html
@@ -0,0 +1,107 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Homo sapiens frequenc', onlyNum = 8;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret = seq.substring(seqi, seqi+lenOut);
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret = s + seq.substring(0, seqi);
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret = line.join('');
+    n -= line.length;
+  }
+}
+
+startTest("real-fasta");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "Homo sapiens alu", n, function(){
+		ret = fastaRepeat(2*n*100000, ALU);
+	});
+	
+	test( "IUB ambiguity codes", n, function(){
+		ret = fastaRandom(3*n*1000, IUB);
+	});
+	
+	test( "Homo sapiens frequenc", n, function(){
+		ret = fastaRandom(5*n*1000, HomoSap);
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-morph-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-morph-1.html
new file mode 100644
index 00000000000..4766abd819c
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-morph-1.html
@@ -0,0 +1,44 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Mesh Transform', onlyNum = 16;
+function thisTest() {
+
+// Test from here:
+// http://webkit.org/misc/morph.html
+
+startTest("real-morph");
+
+var loops = 60, nx, nz;
+
+function morph(a,f) {
+    var PI2nx = Math.PI * 8/nx;
+    var sin = Math.sin;
+    var f30 = -(50 * sin(f*Math.PI*2));
+    
+    for (var i = 0; i < nz; ++i) {
+        for (var j = 0; j < nx; ++j) {
+            a[3*(i*nx+j)+1]    = sin((j-1) * PI2nx ) * -f30
+        }
+    }
+}
+
+    
+var a = Array();
+for (var i=0; i < nx*nz*3; ++i)
+	a[i] = 0;
+
+for ( var size = 16; size <= 128; size *= 2 ) (function(size){
+	nz = nx = size;
+	test("Mesh Transform", size, function(){
+		for (var i = 0; i < loops; ++i) {
+    			morph(a, i/loops)
+		}
+	});
+})(size);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-morph-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-morph-2.html
new file mode 100644
index 00000000000..e28ea746f29
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-morph-2.html
@@ -0,0 +1,44 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Mesh Transform', onlyNum = 32;
+function thisTest() {
+
+// Test from here:
+// http://webkit.org/misc/morph.html
+
+startTest("real-morph");
+
+var loops = 60, nx, nz;
+
+function morph(a,f) {
+    var PI2nx = Math.PI * 8/nx;
+    var sin = Math.sin;
+    var f30 = -(50 * sin(f*Math.PI*2));
+    
+    for (var i = 0; i < nz; ++i) {
+        for (var j = 0; j < nx; ++j) {
+            a[3*(i*nx+j)+1]    = sin((j-1) * PI2nx ) * -f30
+        }
+    }
+}
+
+    
+var a = Array();
+for (var i=0; i < nx*nz*3; ++i)
+	a[i] = 0;
+
+for ( var size = 16; size <= 128; size *= 2 ) (function(size){
+	nz = nx = size;
+	test("Mesh Transform", size, function(){
+		for (var i = 0; i < loops; ++i) {
+    			morph(a, i/loops)
+		}
+	});
+})(size);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-morph-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-morph-3.html
new file mode 100644
index 00000000000..8152bd50557
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-morph-3.html
@@ -0,0 +1,44 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Mesh Transform', onlyNum = 64;
+function thisTest() {
+
+// Test from here:
+// http://webkit.org/misc/morph.html
+
+startTest("real-morph");
+
+var loops = 60, nx, nz;
+
+function morph(a,f) {
+    var PI2nx = Math.PI * 8/nx;
+    var sin = Math.sin;
+    var f30 = -(50 * sin(f*Math.PI*2));
+    
+    for (var i = 0; i < nz; ++i) {
+        for (var j = 0; j < nx; ++j) {
+            a[3*(i*nx+j)+1]    = sin((j-1) * PI2nx ) * -f30
+        }
+    }
+}
+
+    
+var a = Array();
+for (var i=0; i < nx*nz*3; ++i)
+	a[i] = 0;
+
+for ( var size = 16; size <= 128; size *= 2 ) (function(size){
+	nz = nx = size;
+	test("Mesh Transform", size, function(){
+		for (var i = 0; i < loops; ++i) {
+    			morph(a, i/loops)
+		}
+	});
+})(size);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-morph-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-morph-4.html
new file mode 100644
index 00000000000..d7f4ee0ef1b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-morph-4.html
@@ -0,0 +1,44 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Mesh Transform', onlyNum = 128;
+function thisTest() {
+
+// Test from here:
+// http://webkit.org/misc/morph.html
+
+startTest("real-morph");
+
+var loops = 60, nx, nz;
+
+function morph(a,f) {
+    var PI2nx = Math.PI * 8/nx;
+    var sin = Math.sin;
+    var f30 = -(50 * sin(f*Math.PI*2));
+    
+    for (var i = 0; i < nz; ++i) {
+        for (var j = 0; j < nx; ++j) {
+            a[3*(i*nx+j)+1]    = sin((j-1) * PI2nx ) * -f30
+        }
+    }
+}
+
+    
+var a = Array();
+for (var i=0; i < nx*nz*3; ++i)
+	a[i] = 0;
+
+for ( var size = 16; size <= 128; size *= 2 ) (function(size){
+	nz = nx = size;
+	test("Mesh Transform", size, function(){
+		for (var i = 0; i < loops; ++i) {
+    			morph(a, i/loops)
+		}
+	});
+})(size);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-1.html
new file mode 100644
index 00000000000..addb8fab018
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-1.html
@@ -0,0 +1,183 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Body', onlyNum = 2;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+var PI = 3.141592653589793;
+var SOLAR_MASS = 4 * PI * PI;
+var DAYS_PER_YEAR = 365.24;
+
+function Body(x,y,z,vx,vy,vz,mass){
+   this.x = x;
+   this.y = y;
+   this.z = z;
+   this.vx = vx;
+   this.vy = vy;
+   this.vz = vz;
+   this.mass = mass;
+}
+
+Body.prototype.offsetMomentum = function(px,py,pz) {
+   this.vx = -px / SOLAR_MASS;
+   this.vy = -py / SOLAR_MASS;
+   this.vz = -pz / SOLAR_MASS;
+   return this;
+}
+
+function Jupiter(){
+   return new Body(
+      4.84143144246472090e+00,
+      -1.16032004402742839e+00,
+      -1.03622044471123109e-01,
+      1.66007664274403694e-03 * DAYS_PER_YEAR,
+      7.69901118419740425e-03 * DAYS_PER_YEAR,
+      -6.90460016972063023e-05 * DAYS_PER_YEAR,
+      9.54791938424326609e-04 * SOLAR_MASS
+   );
+}
+
+function Saturn(){
+   return new Body(
+      8.34336671824457987e+00,
+      4.12479856412430479e+00,
+      -4.03523417114321381e-01,
+      -2.76742510726862411e-03 * DAYS_PER_YEAR,
+      4.99852801234917238e-03 * DAYS_PER_YEAR,
+      2.30417297573763929e-05 * DAYS_PER_YEAR,
+      2.85885980666130812e-04 * SOLAR_MASS
+   );
+}
+
+function Uranus(){
+   return new Body(
+      1.28943695621391310e+01,
+      -1.51111514016986312e+01,
+      -2.23307578892655734e-01,
+      2.96460137564761618e-03 * DAYS_PER_YEAR,
+      2.37847173959480950e-03 * DAYS_PER_YEAR,
+      -2.96589568540237556e-05 * DAYS_PER_YEAR,
+      4.36624404335156298e-05 * SOLAR_MASS
+   );
+}
+
+function Neptune(){
+   return new Body(
+      1.53796971148509165e+01,
+      -2.59193146099879641e+01,
+      1.79258772950371181e-01,
+      2.68067772490389322e-03 * DAYS_PER_YEAR,
+      1.62824170038242295e-03 * DAYS_PER_YEAR,
+      -9.51592254519715870e-05 * DAYS_PER_YEAR,
+      5.15138902046611451e-05 * SOLAR_MASS
+   );
+}
+
+function Sun(){
+   return new Body(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, SOLAR_MASS);
+}
+
+
+function NBodySystem(bodies){
+   this.bodies = bodies;
+   var px = 0.0;
+   var py = 0.0;
+   var pz = 0.0;
+   var size = this.bodies.length;
+   for (var i=0; i<size; i++){
+      var b = this.bodies[i];
+      var m = b.mass;
+      px += b.vx * m;
+      py += b.vy * m;
+      pz += b.vz * m;
+   }
+   this.bodies[0].offsetMomentum(px,py,pz);
+}
+
+NBodySystem.prototype.advance = function(dt){
+   var dx, dy, dz, distance, mag;
+   var size = this.bodies.length;
+
+   for (var i=0; i<size; i++) {
+      var bodyi = this.bodies[i];
+      for (var j=i+1; j<size; j++) {
+         var bodyj = this.bodies[j];
+         dx = bodyi.x - bodyj.x;
+         dy = bodyi.y - bodyj.y;
+         dz = bodyi.z - bodyj.z;
+
+         distance = Math.sqrt(dx*dx + dy*dy + dz*dz);
+         mag = dt / (distance * distance * distance);
+
+         bodyi.vx -= dx * bodyj.mass * mag;
+         bodyi.vy -= dy * bodyj.mass * mag;
+         bodyi.vz -= dz * bodyj.mass * mag;
+
+         bodyj.vx += dx * bodyi.mass * mag;
+         bodyj.vy += dy * bodyi.mass * mag;
+         bodyj.vz += dz * bodyi.mass * mag;
+      }
+   }
+
+   for (var i=0; i<size; i++) {
+      var body = this.bodies[i];
+      body.x += dt * body.vx;
+      body.y += dt * body.vy;
+      body.z += dt * body.vz;
+   }
+}
+
+NBodySystem.prototype.energy = function(){
+   var dx, dy, dz, distance;
+   var e = 0.0;
+   var size = this.bodies.length;
+
+   for (var i=0; i<size; i++) {
+      var bodyi = this.bodies[i];
+
+      e += 0.5 * bodyi.mass *
+         ( bodyi.vx * bodyi.vx
+         + bodyi.vy * bodyi.vy
+         + bodyi.vz * bodyi.vz );
+
+      for (var j=i+1; j<size; j++) {
+         var bodyj = this.bodies[j];
+         dx = bodyi.x - bodyj.x;
+         dy = bodyi.y - bodyj.y;
+         dz = bodyi.z - bodyj.z;
+
+         distance = Math.sqrt(dx*dx + dy*dy + dz*dz);
+         e -= (bodyi.mass * bodyj.mass) / distance;
+      }
+   }
+   return e;
+}
+
+startTest("real-nbody");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "N-Body", n, function(){
+		var bodies = new NBodySystem( Array(
+		   Sun(),Jupiter(),Saturn(),Uranus(),Neptune()
+		));
+		var max = n * 100;
+		
+		ret = bodies.energy();
+		for (var i=0; i<max; i++){
+			bodies.advance(0.01);
+		}
+		ret = bodies.energy();
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-2.html
new file mode 100644
index 00000000000..5c3b19b951a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-2.html
@@ -0,0 +1,183 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Body', onlyNum = 4;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+var PI = 3.141592653589793;
+var SOLAR_MASS = 4 * PI * PI;
+var DAYS_PER_YEAR = 365.24;
+
+function Body(x,y,z,vx,vy,vz,mass){
+   this.x = x;
+   this.y = y;
+   this.z = z;
+   this.vx = vx;
+   this.vy = vy;
+   this.vz = vz;
+   this.mass = mass;
+}
+
+Body.prototype.offsetMomentum = function(px,py,pz) {
+   this.vx = -px / SOLAR_MASS;
+   this.vy = -py / SOLAR_MASS;
+   this.vz = -pz / SOLAR_MASS;
+   return this;
+}
+
+function Jupiter(){
+   return new Body(
+      4.84143144246472090e+00,
+      -1.16032004402742839e+00,
+      -1.03622044471123109e-01,
+      1.66007664274403694e-03 * DAYS_PER_YEAR,
+      7.69901118419740425e-03 * DAYS_PER_YEAR,
+      -6.90460016972063023e-05 * DAYS_PER_YEAR,
+      9.54791938424326609e-04 * SOLAR_MASS
+   );
+}
+
+function Saturn(){
+   return new Body(
+      8.34336671824457987e+00,
+      4.12479856412430479e+00,
+      -4.03523417114321381e-01,
+      -2.76742510726862411e-03 * DAYS_PER_YEAR,
+      4.99852801234917238e-03 * DAYS_PER_YEAR,
+      2.30417297573763929e-05 * DAYS_PER_YEAR,
+      2.85885980666130812e-04 * SOLAR_MASS
+   );
+}
+
+function Uranus(){
+   return new Body(
+      1.28943695621391310e+01,
+      -1.51111514016986312e+01,
+      -2.23307578892655734e-01,
+      2.96460137564761618e-03 * DAYS_PER_YEAR,
+      2.37847173959480950e-03 * DAYS_PER_YEAR,
+      -2.96589568540237556e-05 * DAYS_PER_YEAR,
+      4.36624404335156298e-05 * SOLAR_MASS
+   );
+}
+
+function Neptune(){
+   return new Body(
+      1.53796971148509165e+01,
+      -2.59193146099879641e+01,
+      1.79258772950371181e-01,
+      2.68067772490389322e-03 * DAYS_PER_YEAR,
+      1.62824170038242295e-03 * DAYS_PER_YEAR,
+      -9.51592254519715870e-05 * DAYS_PER_YEAR,
+      5.15138902046611451e-05 * SOLAR_MASS
+   );
+}
+
+function Sun(){
+   return new Body(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, SOLAR_MASS);
+}
+
+
+function NBodySystem(bodies){
+   this.bodies = bodies;
+   var px = 0.0;
+   var py = 0.0;
+   var pz = 0.0;
+   var size = this.bodies.length;
+   for (var i=0; i<size; i++){
+      var b = this.bodies[i];
+      var m = b.mass;
+      px += b.vx * m;
+      py += b.vy * m;
+      pz += b.vz * m;
+   }
+   this.bodies[0].offsetMomentum(px,py,pz);
+}
+
+NBodySystem.prototype.advance = function(dt){
+   var dx, dy, dz, distance, mag;
+   var size = this.bodies.length;
+
+   for (var i=0; i<size; i++) {
+      var bodyi = this.bodies[i];
+      for (var j=i+1; j<size; j++) {
+         var bodyj = this.bodies[j];
+         dx = bodyi.x - bodyj.x;
+         dy = bodyi.y - bodyj.y;
+         dz = bodyi.z - bodyj.z;
+
+         distance = Math.sqrt(dx*dx + dy*dy + dz*dz);
+         mag = dt / (distance * distance * distance);
+
+         bodyi.vx -= dx * bodyj.mass * mag;
+         bodyi.vy -= dy * bodyj.mass * mag;
+         bodyi.vz -= dz * bodyj.mass * mag;
+
+         bodyj.vx += dx * bodyi.mass * mag;
+         bodyj.vy += dy * bodyi.mass * mag;
+         bodyj.vz += dz * bodyi.mass * mag;
+      }
+   }
+
+   for (var i=0; i<size; i++) {
+      var body = this.bodies[i];
+      body.x += dt * body.vx;
+      body.y += dt * body.vy;
+      body.z += dt * body.vz;
+   }
+}
+
+NBodySystem.prototype.energy = function(){
+   var dx, dy, dz, distance;
+   var e = 0.0;
+   var size = this.bodies.length;
+
+   for (var i=0; i<size; i++) {
+      var bodyi = this.bodies[i];
+
+      e += 0.5 * bodyi.mass *
+         ( bodyi.vx * bodyi.vx
+         + bodyi.vy * bodyi.vy
+         + bodyi.vz * bodyi.vz );
+
+      for (var j=i+1; j<size; j++) {
+         var bodyj = this.bodies[j];
+         dx = bodyi.x - bodyj.x;
+         dy = bodyi.y - bodyj.y;
+         dz = bodyi.z - bodyj.z;
+
+         distance = Math.sqrt(dx*dx + dy*dy + dz*dz);
+         e -= (bodyi.mass * bodyj.mass) / distance;
+      }
+   }
+   return e;
+}
+
+startTest("real-nbody");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "N-Body", n, function(){
+		var bodies = new NBodySystem( Array(
+		   Sun(),Jupiter(),Saturn(),Uranus(),Neptune()
+		));
+		var max = n * 100;
+		
+		ret = bodies.energy();
+		for (var i=0; i<max; i++){
+			bodies.advance(0.01);
+		}
+		ret = bodies.energy();
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-3.html
new file mode 100644
index 00000000000..345891e326b
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-3.html
@@ -0,0 +1,183 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Body', onlyNum = 8;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+var PI = 3.141592653589793;
+var SOLAR_MASS = 4 * PI * PI;
+var DAYS_PER_YEAR = 365.24;
+
+function Body(x,y,z,vx,vy,vz,mass){
+   this.x = x;
+   this.y = y;
+   this.z = z;
+   this.vx = vx;
+   this.vy = vy;
+   this.vz = vz;
+   this.mass = mass;
+}
+
+Body.prototype.offsetMomentum = function(px,py,pz) {
+   this.vx = -px / SOLAR_MASS;
+   this.vy = -py / SOLAR_MASS;
+   this.vz = -pz / SOLAR_MASS;
+   return this;
+}
+
+function Jupiter(){
+   return new Body(
+      4.84143144246472090e+00,
+      -1.16032004402742839e+00,
+      -1.03622044471123109e-01,
+      1.66007664274403694e-03 * DAYS_PER_YEAR,
+      7.69901118419740425e-03 * DAYS_PER_YEAR,
+      -6.90460016972063023e-05 * DAYS_PER_YEAR,
+      9.54791938424326609e-04 * SOLAR_MASS
+   );
+}
+
+function Saturn(){
+   return new Body(
+      8.34336671824457987e+00,
+      4.12479856412430479e+00,
+      -4.03523417114321381e-01,
+      -2.76742510726862411e-03 * DAYS_PER_YEAR,
+      4.99852801234917238e-03 * DAYS_PER_YEAR,
+      2.30417297573763929e-05 * DAYS_PER_YEAR,
+      2.85885980666130812e-04 * SOLAR_MASS
+   );
+}
+
+function Uranus(){
+   return new Body(
+      1.28943695621391310e+01,
+      -1.51111514016986312e+01,
+      -2.23307578892655734e-01,
+      2.96460137564761618e-03 * DAYS_PER_YEAR,
+      2.37847173959480950e-03 * DAYS_PER_YEAR,
+      -2.96589568540237556e-05 * DAYS_PER_YEAR,
+      4.36624404335156298e-05 * SOLAR_MASS
+   );
+}
+
+function Neptune(){
+   return new Body(
+      1.53796971148509165e+01,
+      -2.59193146099879641e+01,
+      1.79258772950371181e-01,
+      2.68067772490389322e-03 * DAYS_PER_YEAR,
+      1.62824170038242295e-03 * DAYS_PER_YEAR,
+      -9.51592254519715870e-05 * DAYS_PER_YEAR,
+      5.15138902046611451e-05 * SOLAR_MASS
+   );
+}
+
+function Sun(){
+   return new Body(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, SOLAR_MASS);
+}
+
+
+function NBodySystem(bodies){
+   this.bodies = bodies;
+   var px = 0.0;
+   var py = 0.0;
+   var pz = 0.0;
+   var size = this.bodies.length;
+   for (var i=0; i<size; i++){
+      var b = this.bodies[i];
+      var m = b.mass;
+      px += b.vx * m;
+      py += b.vy * m;
+      pz += b.vz * m;
+   }
+   this.bodies[0].offsetMomentum(px,py,pz);
+}
+
+NBodySystem.prototype.advance = function(dt){
+   var dx, dy, dz, distance, mag;
+   var size = this.bodies.length;
+
+   for (var i=0; i<size; i++) {
+      var bodyi = this.bodies[i];
+      for (var j=i+1; j<size; j++) {
+         var bodyj = this.bodies[j];
+         dx = bodyi.x - bodyj.x;
+         dy = bodyi.y - bodyj.y;
+         dz = bodyi.z - bodyj.z;
+
+         distance = Math.sqrt(dx*dx + dy*dy + dz*dz);
+         mag = dt / (distance * distance * distance);
+
+         bodyi.vx -= dx * bodyj.mass * mag;
+         bodyi.vy -= dy * bodyj.mass * mag;
+         bodyi.vz -= dz * bodyj.mass * mag;
+
+         bodyj.vx += dx * bodyi.mass * mag;
+         bodyj.vy += dy * bodyi.mass * mag;
+         bodyj.vz += dz * bodyi.mass * mag;
+      }
+   }
+
+   for (var i=0; i<size; i++) {
+      var body = this.bodies[i];
+      body.x += dt * body.vx;
+      body.y += dt * body.vy;
+      body.z += dt * body.vz;
+   }
+}
+
+NBodySystem.prototype.energy = function(){
+   var dx, dy, dz, distance;
+   var e = 0.0;
+   var size = this.bodies.length;
+
+   for (var i=0; i<size; i++) {
+      var bodyi = this.bodies[i];
+
+      e += 0.5 * bodyi.mass *
+         ( bodyi.vx * bodyi.vx
+         + bodyi.vy * bodyi.vy
+         + bodyi.vz * bodyi.vz );
+
+      for (var j=i+1; j<size; j++) {
+         var bodyj = this.bodies[j];
+         dx = bodyi.x - bodyj.x;
+         dy = bodyi.y - bodyj.y;
+         dz = bodyi.z - bodyj.z;
+
+         distance = Math.sqrt(dx*dx + dy*dy + dz*dz);
+         e -= (bodyi.mass * bodyj.mass) / distance;
+      }
+   }
+   return e;
+}
+
+startTest("real-nbody");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "N-Body", n, function(){
+		var bodies = new NBodySystem( Array(
+		   Sun(),Jupiter(),Saturn(),Uranus(),Neptune()
+		));
+		var max = n * 100;
+		
+		ret = bodies.energy();
+		for (var i=0; i<max; i++){
+			bodies.advance(0.01);
+		}
+		ret = bodies.energy();
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-4.html
new file mode 100644
index 00000000000..9e2d5062568
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nbody-4.html
@@ -0,0 +1,183 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Body', onlyNum = 16;
+function thisTest() {
+
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+var PI = 3.141592653589793;
+var SOLAR_MASS = 4 * PI * PI;
+var DAYS_PER_YEAR = 365.24;
+
+function Body(x,y,z,vx,vy,vz,mass){
+   this.x = x;
+   this.y = y;
+   this.z = z;
+   this.vx = vx;
+   this.vy = vy;
+   this.vz = vz;
+   this.mass = mass;
+}
+
+Body.prototype.offsetMomentum = function(px,py,pz) {
+   this.vx = -px / SOLAR_MASS;
+   this.vy = -py / SOLAR_MASS;
+   this.vz = -pz / SOLAR_MASS;
+   return this;
+}
+
+function Jupiter(){
+   return new Body(
+      4.84143144246472090e+00,
+      -1.16032004402742839e+00,
+      -1.03622044471123109e-01,
+      1.66007664274403694e-03 * DAYS_PER_YEAR,
+      7.69901118419740425e-03 * DAYS_PER_YEAR,
+      -6.90460016972063023e-05 * DAYS_PER_YEAR,
+      9.54791938424326609e-04 * SOLAR_MASS
+   );
+}
+
+function Saturn(){
+   return new Body(
+      8.34336671824457987e+00,
+      4.12479856412430479e+00,
+      -4.03523417114321381e-01,
+      -2.76742510726862411e-03 * DAYS_PER_YEAR,
+      4.99852801234917238e-03 * DAYS_PER_YEAR,
+      2.30417297573763929e-05 * DAYS_PER_YEAR,
+      2.85885980666130812e-04 * SOLAR_MASS
+   );
+}
+
+function Uranus(){
+   return new Body(
+      1.28943695621391310e+01,
+      -1.51111514016986312e+01,
+      -2.23307578892655734e-01,
+      2.96460137564761618e-03 * DAYS_PER_YEAR,
+      2.37847173959480950e-03 * DAYS_PER_YEAR,
+      -2.96589568540237556e-05 * DAYS_PER_YEAR,
+      4.36624404335156298e-05 * SOLAR_MASS
+   );
+}
+
+function Neptune(){
+   return new Body(
+      1.53796971148509165e+01,
+      -2.59193146099879641e+01,
+      1.79258772950371181e-01,
+      2.68067772490389322e-03 * DAYS_PER_YEAR,
+      1.62824170038242295e-03 * DAYS_PER_YEAR,
+      -9.51592254519715870e-05 * DAYS_PER_YEAR,
+      5.15138902046611451e-05 * SOLAR_MASS
+   );
+}
+
+function Sun(){
+   return new Body(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, SOLAR_MASS);
+}
+
+
+function NBodySystem(bodies){
+   this.bodies = bodies;
+   var px = 0.0;
+   var py = 0.0;
+   var pz = 0.0;
+   var size = this.bodies.length;
+   for (var i=0; i<size; i++){
+      var b = this.bodies[i];
+      var m = b.mass;
+      px += b.vx * m;
+      py += b.vy * m;
+      pz += b.vz * m;
+   }
+   this.bodies[0].offsetMomentum(px,py,pz);
+}
+
+NBodySystem.prototype.advance = function(dt){
+   var dx, dy, dz, distance, mag;
+   var size = this.bodies.length;
+
+   for (var i=0; i<size; i++) {
+      var bodyi = this.bodies[i];
+      for (var j=i+1; j<size; j++) {
+         var bodyj = this.bodies[j];
+         dx = bodyi.x - bodyj.x;
+         dy = bodyi.y - bodyj.y;
+         dz = bodyi.z - bodyj.z;
+
+         distance = Math.sqrt(dx*dx + dy*dy + dz*dz);
+         mag = dt / (distance * distance * distance);
+
+         bodyi.vx -= dx * bodyj.mass * mag;
+         bodyi.vy -= dy * bodyj.mass * mag;
+         bodyi.vz -= dz * bodyj.mass * mag;
+
+         bodyj.vx += dx * bodyi.mass * mag;
+         bodyj.vy += dy * bodyi.mass * mag;
+         bodyj.vz += dz * bodyi.mass * mag;
+      }
+   }
+
+   for (var i=0; i<size; i++) {
+      var body = this.bodies[i];
+      body.x += dt * body.vx;
+      body.y += dt * body.vy;
+      body.z += dt * body.vz;
+   }
+}
+
+NBodySystem.prototype.energy = function(){
+   var dx, dy, dz, distance;
+   var e = 0.0;
+   var size = this.bodies.length;
+
+   for (var i=0; i<size; i++) {
+      var bodyi = this.bodies[i];
+
+      e += 0.5 * bodyi.mass *
+         ( bodyi.vx * bodyi.vx
+         + bodyi.vy * bodyi.vy
+         + bodyi.vz * bodyi.vz );
+
+      for (var j=i+1; j<size; j++) {
+         var bodyj = this.bodies[j];
+         dx = bodyi.x - bodyj.x;
+         dy = bodyi.y - bodyj.y;
+         dz = bodyi.z - bodyj.z;
+
+         distance = Math.sqrt(dx*dx + dy*dy + dz*dz);
+         e -= (bodyi.mass * bodyj.mass) / distance;
+      }
+   }
+   return e;
+}
+
+startTest("real-nbody");
+
+var ret;
+
+for ( var n = 2; n <= 16; n *= 2 ) (function(n){
+	test( "N-Body", n, function(){
+		var bodies = new NBodySystem( Array(
+		   Sun(),Jupiter(),Saturn(),Uranus(),Neptune()
+		));
+		var max = n * 100;
+		
+		ret = bodies.energy();
+		for (var i=0; i<max; i++){
+			bodies.advance(0.01);
+		}
+		ret = bodies.energy();
+	});
+})(n);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-1.html
new file mode 100644
index 00000000000..122b19bfe1d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-1.html
@@ -0,0 +1,50 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Sieve', onlyNum = 1;
+function thisTest() {
+
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// modified by Isaac Gouy
+
+function pad(number,width){
+   var s = number.toString();
+   var prefixWidth = width - s.length;
+   if (prefixWidth>0){
+      for (var i=1; i<=prefixWidth; i++) s = " " + s;
+   }
+   return s;
+}
+
+function nsieve(m, isPrime){
+   var i, k, count;
+
+   for (i=2; i<=m; i++) { isPrime[i] = true; }
+   count = 0;
+
+   for (i=2; i<=m; i++){
+      if (isPrime[i]) {
+         for (k=i+i; k<=m; k+=i) isPrime[k] = false;
+         count++;
+      }
+   }
+   return count;
+}
+
+startTest("real-nsieve");
+
+for ( var i = 1; i <= 4; i++ ) (function(i){
+	test( "N-Sieve", i, function(){
+        var m = (1<<i)*10000;
+        var flags = Array(m+1);
+		nsieve(m,flags);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-2.html
new file mode 100644
index 00000000000..c78218d97ab
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-2.html
@@ -0,0 +1,50 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Sieve', onlyNum = 2;
+function thisTest() {
+
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// modified by Isaac Gouy
+
+function pad(number,width){
+   var s = number.toString();
+   var prefixWidth = width - s.length;
+   if (prefixWidth>0){
+      for (var i=1; i<=prefixWidth; i++) s = " " + s;
+   }
+   return s;
+}
+
+function nsieve(m, isPrime){
+   var i, k, count;
+
+   for (i=2; i<=m; i++) { isPrime[i] = true; }
+   count = 0;
+
+   for (i=2; i<=m; i++){
+      if (isPrime[i]) {
+         for (k=i+i; k<=m; k+=i) isPrime[k] = false;
+         count++;
+      }
+   }
+   return count;
+}
+
+startTest("real-nsieve");
+
+for ( var i = 1; i <= 4; i++ ) (function(i){
+	test( "N-Sieve", i, function(){
+        var m = (1<<i)*10000;
+        var flags = Array(m+1);
+		nsieve(m,flags);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-3.html
new file mode 100644
index 00000000000..335d4b328df
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-3.html
@@ -0,0 +1,50 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Sieve', onlyNum = 3;
+function thisTest() {
+
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// modified by Isaac Gouy
+
+function pad(number,width){
+   var s = number.toString();
+   var prefixWidth = width - s.length;
+   if (prefixWidth>0){
+      for (var i=1; i<=prefixWidth; i++) s = " " + s;
+   }
+   return s;
+}
+
+function nsieve(m, isPrime){
+   var i, k, count;
+
+   for (i=2; i<=m; i++) { isPrime[i] = true; }
+   count = 0;
+
+   for (i=2; i<=m; i++){
+      if (isPrime[i]) {
+         for (k=i+i; k<=m; k+=i) isPrime[k] = false;
+         count++;
+      }
+   }
+   return count;
+}
+
+startTest("real-nsieve");
+
+for ( var i = 1; i <= 4; i++ ) (function(i){
+	test( "N-Sieve", i, function(){
+        var m = (1<<i)*10000;
+        var flags = Array(m+1);
+		nsieve(m,flags);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-4.html
new file mode 100644
index 00000000000..a3e0737455a
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-4.html
@@ -0,0 +1,50 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Sieve', onlyNum = 4;
+function thisTest() {
+
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// modified by Isaac Gouy
+
+function pad(number,width){
+   var s = number.toString();
+   var prefixWidth = width - s.length;
+   if (prefixWidth>0){
+      for (var i=1; i<=prefixWidth; i++) s = " " + s;
+   }
+   return s;
+}
+
+function nsieve(m, isPrime){
+   var i, k, count;
+
+   for (i=2; i<=m; i++) { isPrime[i] = true; }
+   count = 0;
+
+   for (i=2; i<=m; i++){
+      if (isPrime[i]) {
+         for (k=i+i; k<=m; k+=i) isPrime[k] = false;
+         count++;
+      }
+   }
+   return count;
+}
+
+startTest("real-nsieve");
+
+for ( var i = 1; i <= 4; i++ ) (function(i){
+	test( "N-Sieve", i, function(){
+        var m = (1<<i)*10000;
+        var flags = Array(m+1);
+		nsieve(m,flags);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-1.html
new file mode 100644
index 00000000000..18c817fdc91
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-1.html
@@ -0,0 +1,44 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Sieve Bits', onlyNum = 1;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+function pad(n,width) {
+  var s = n.toString();
+  while (s.length < width) s = ' ' + s;
+  return s;
+}
+
+function primes(isPrime, n) {
+  var i, count = 0, m = 10000<<n, size = m+31>>5;
+
+  for (i=0; i<size; i++) isPrime[i] = 0xffffffff;
+
+  for (i=2; i<m; i++)
+    if (isPrime[i>>5] & 1<<(i&31)) {
+      for (var j=i+i; j<m; j+=i)
+        isPrime[j>>5] &= ~(1<<(j&31));
+      count++;
+    }
+}
+
+startTest("real-nsieve-bits");
+
+for ( var i = 1; i <= 4; i++ ) (function(i){
+	test( "N-Sieve Bits", i, function(){
+		var isPrime = new Array((10000<<i)+31>>5);
+		primes(isPrime, i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-2.html
new file mode 100644
index 00000000000..143f0652c66
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-2.html
@@ -0,0 +1,44 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Sieve Bits', onlyNum = 2;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+function pad(n,width) {
+  var s = n.toString();
+  while (s.length < width) s = ' ' + s;
+  return s;
+}
+
+function primes(isPrime, n) {
+  var i, count = 0, m = 10000<<n, size = m+31>>5;
+
+  for (i=0; i<size; i++) isPrime[i] = 0xffffffff;
+
+  for (i=2; i<m; i++)
+    if (isPrime[i>>5] & 1<<(i&31)) {
+      for (var j=i+i; j<m; j+=i)
+        isPrime[j>>5] &= ~(1<<(j&31));
+      count++;
+    }
+}
+
+startTest("real-nsieve-bits");
+
+for ( var i = 1; i <= 4; i++ ) (function(i){
+	test( "N-Sieve Bits", i, function(){
+		var isPrime = new Array((10000<<i)+31>>5);
+		primes(isPrime, i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-3.html
new file mode 100644
index 00000000000..9ab08d965c8
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-3.html
@@ -0,0 +1,44 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Sieve Bits', onlyNum = 3;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+function pad(n,width) {
+  var s = n.toString();
+  while (s.length < width) s = ' ' + s;
+  return s;
+}
+
+function primes(isPrime, n) {
+  var i, count = 0, m = 10000<<n, size = m+31>>5;
+
+  for (i=0; i<size; i++) isPrime[i] = 0xffffffff;
+
+  for (i=2; i<m; i++)
+    if (isPrime[i>>5] & 1<<(i&31)) {
+      for (var j=i+i; j<m; j+=i)
+        isPrime[j>>5] &= ~(1<<(j&31));
+      count++;
+    }
+}
+
+startTest("real-nsieve-bits");
+
+for ( var i = 1; i <= 4; i++ ) (function(i){
+	test( "N-Sieve Bits", i, function(){
+		var isPrime = new Array((10000<<i)+31>>5);
+		primes(isPrime, i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-4.html
new file mode 100644
index 00000000000..2afb2ddcc39
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-nsieve-bits-4.html
@@ -0,0 +1,44 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'N-Sieve Bits', onlyNum = 4;
+function thisTest() {
+
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+function pad(n,width) {
+  var s = n.toString();
+  while (s.length < width) s = ' ' + s;
+  return s;
+}
+
+function primes(isPrime, n) {
+  var i, count = 0, m = 10000<<n, size = m+31>>5;
+
+  for (i=0; i<size; i++) isPrime[i] = 0xffffffff;
+
+  for (i=2; i<m; i++)
+    if (isPrime[i>>5] & 1<<(i&31)) {
+      for (var j=i+i; j<m; j+=i)
+        isPrime[j>>5] &= ~(1<<(j&31));
+      count++;
+    }
+}
+
+startTest("real-nsieve-bits");
+
+for ( var i = 1; i <= 4; i++ ) (function(i){
+	test( "N-Sieve Bits", i, function(){
+		var isPrime = new Array((10000<<i)+31>>5);
+		primes(isPrime, i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-packer-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-packer-1.html
new file mode 100644
index 00000000000..8805ae93078
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-packer-1.html
@@ -0,0 +1,33 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Unpack', onlyNum = 1;
+function thisTest() {
+
+startTest("real-packer");
+
+test("Unpack", 1, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="O";0 1="5";0 1="2";0 1="4";0 1="J";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="u";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="t";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="P";',52,52,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|wrijmpchex|lccbddnnxf|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|vmkvdsnxsa|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|hgakyyhysh|iereeyrdnh'.split('|'),0,{}))
+});
+
+test("Unpack", 2, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('1 0="1C";1 0="5";1 0="2";1 0="4";1 0="1v";1 0="6";1 0="7";1 0="8";1 0="3";1 0="a";1 0="b";1 0="c";1 0="10";1 0="d";1 0="f";1 0="g";1 0="h";1 0="i";1 0="j";1 0="k";1 0="9";1 0="m";1 0="n";1 0="o";1 0="p";1 0="q";1 0="r";1 0="s";1 0="Z";1 0="e";1 0="v";1 0="w";1 0="x";1 0="y";1 0="z";1 0="A";1 0="B";1 0="C";1 0="D";1 0="E";1 0="F";1 0="G";1 0="H";1 0="I";1 0="l";1 0="K";1 0="L";1 0="M";1 0="N";1 0="O";1 0="P";1 0="Q";1 0="R";1 0="S";1 0="T";1 0="U";1 0="V";1 0="W";1 0="X";1 0="Y";1 0="u";1 0="t";1 0="11";1 0="12";1 0="13";1 0="14";1 0="15";1 0="16";1 0="17";1 0="18";1 0="19";1 0="1a";1 0="1b";1 0="1c";1 0="1d";1 0="1e";1 0="1f";1 0="1g";1 0="1h";1 0="1i";1 0="1j";1 0="1k";1 0="1l";1 0="1m";1 0="1n";1 0="1o";1 0="1p";1 0="1q";1 0="1r";1 0="1s";1 0="1t";1 0="1u";1 0="J";1 0="1w";1 0="1x";1 0="1y";1 0="1z";1 0="1A";1 0="1B";1 0="1D";',62,102,'aaa|var|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|bcvtqsyrbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|wrijmpchex|lccbddnnxf|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|vmkvdsnxsa|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|hgakyyhysh|rsbgawetse'.split('|'),0,{}))
+});
+
+test("Unpack", 4, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="3e";0 1="5";0 1="2";0 1="4";0 1="33";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="22";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="21";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="O";0 1="P";0 1="Q";0 1="R";0 1="S";0 1="T";0 1="U";0 1="V";0 1="W";0 1="X";0 1="Y";0 1="10";0 1="t";0 1="11";0 1="12";0 1="13";0 1="14";0 1="15";0 1="16";0 1="17";0 1="18";0 1="19";0 1="1a";0 1="1b";0 1="1c";0 1="1d";0 1="1e";0 1="1f";0 1="1g";0 1="1h";0 1="1i";0 1="1j";0 1="1k";0 1="1l";0 1="1m";0 1="1n";0 1="1o";0 1="1p";0 1="1q";0 1="1r";0 1="1s";0 1="1t";0 1="1u";0 1="J";0 1="1w";0 1="1x";0 1="1y";0 1="1z";0 1="1A";0 1="1B";0 1="1C";0 1="1D";0 1="1E";0 1="1F";0 1="1G";0 1="1H";0 1="1I";0 1="1J";0 1="1K";0 1="1L";0 1="1M";0 1="1N";0 1="1O";0 1="1P";0 1="1Q";0 1="1R";0 1="1S";0 1="1T";0 1="1U";0 1="1V";0 1="1W";0 1="1X";0 1="1Y";0 1="1Z";0 1="20";0 1="Z";0 1="u";0 1="23";0 1="24";0 1="25";0 1="26";0 1="27";0 1="28";0 1="29";0 1="2a";0 1="2b";0 1="2c";0 1="2d";0 1="2e";0 1="2f";0 1="2g";0 1="2h";0 1="2i";0 1="2j";0 1="2k";0 1="2l";0 1="2m";0 1="2n";0 1="2o";0 1="2p";0 1="2q";0 1="2r";0 1="2s";0 1="2t";0 1="2u";0 1="2v";0 1="2w";0 1="2x";0 1="2y";0 1="2z";0 1="2A";0 1="2B";0 1="2C";0 1="2D";0 1="2E";0 1="2F";0 1="2G";0 1="2H";0 1="2I";0 1="2J";0 1="2K";0 1="2L";0 1="2M";0 1="2N";0 1="2O";0 1="2P";0 1="2Q";0 1="2R";0 1="2S";0 1="2T";0 1="2U";0 1="2V";0 1="2W";0 1="2X";0 1="2Y";0 1="2Z";0 1="30";0 1="31";0 1="32";0 1="1v";0 1="34";0 1="35";0 1="36";0 1="37";0 1="38";0 1="39";0 1="3a";0 1="3b";0 1="3c";0 1="3d";0 1="3f";',62,202,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|klucopuyfg|bcvtqsyrbw|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|wrijmpchex|lccbddnnxf|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|vmkvdsnxsa|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|hgakyyhysh|prrrrbwosb'.split('|'),0,{}))
+});
+
+test("Unpack", 8, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="5E";0 1="5";0 1="2";0 1="4";0 1="45";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="33";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="22";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="O";0 1="P";0 1="Q";0 1="R";0 1="S";0 1="T";0 1="U";0 1="V";0 1="W";0 1="X";0 1="Y";0 1="21";0 1="t";0 1="11";0 1="12";0 1="13";0 1="14";0 1="15";0 1="16";0 1="17";0 1="18";0 1="19";0 1="1a";0 1="1b";0 1="1c";0 1="1d";0 1="1e";0 1="1f";0 1="1g";0 1="1h";0 1="1i";0 1="1j";0 1="1k";0 1="1l";0 1="1m";0 1="1n";0 1="1o";0 1="1p";0 1="1q";0 1="1r";0 1="1s";0 1="1t";0 1="1u";0 1="J";0 1="1w";0 1="1x";0 1="1y";0 1="1z";0 1="1A";0 1="1B";0 1="1C";0 1="1D";0 1="1E";0 1="1F";0 1="1G";0 1="1H";0 1="1I";0 1="1J";0 1="1K";0 1="1L";0 1="1M";0 1="1N";0 1="1O";0 1="1P";0 1="1Q";0 1="1R";0 1="1S";0 1="1T";0 1="1U";0 1="1V";0 1="1W";0 1="1X";0 1="1Y";0 1="1Z";0 1="20";0 1="10";0 1="u";0 1="23";0 1="24";0 1="25";0 1="26";0 1="27";0 1="28";0 1="29";0 1="2a";0 1="2b";0 1="2c";0 1="2d";0 1="2e";0 1="2f";0 1="2g";0 1="2h";0 1="2i";0 1="2j";0 1="2k";0 1="2l";0 1="2m";0 1="2n";0 1="2o";0 1="2p";0 1="2q";0 1="2r";0 1="2s";0 1="2t";0 1="2u";0 1="2v";0 1="2w";0 1="2x";0 1="2y";0 1="2z";0 1="2A";0 1="2B";0 1="2C";0 1="2D";0 1="2E";0 1="2F";0 1="2G";0 1="2H";0 1="2I";0 1="2J";0 1="2K";0 1="2L";0 1="2M";0 1="2N";0 1="2O";0 1="2P";0 1="2Q";0 1="2R";0 1="2S";0 1="2T";0 1="2U";0 1="2V";0 1="2W";0 1="2X";0 1="2Y";0 1="2Z";0 1="30";0 1="31";0 1="32";0 1="1v";0 1="34";0 1="35";0 1="36";0 1="37";0 1="38";0 1="39";0 1="3a";0 1="3b";0 1="3c";0 1="3d";0 1="3e";0 1="3f";0 1="3g";0 1="3h";0 1="3i";0 1="3j";0 1="3k";0 1="3l";0 1="3m";0 1="3n";0 1="3o";0 1="3p";0 1="3q";0 1="3r";0 1="3s";0 1="3t";0 1="3u";0 1="3v";0 1="3w";0 1="3x";0 1="3y";0 1="3z";0 1="3A";0 1="3B";0 1="3C";0 1="3D";0 1="3E";0 1="3F";0 1="3G";0 1="3H";0 1="3I";0 1="3J";0 1="3K";0 1="3L";0 1="3M";0 1="3N";0 1="3O";0 1="3P";0 1="3Q";0 1="3R";0 1="3S";0 1="3T";0 1="3U";0 1="3V";0 1="3W";0 1="3X";0 1="3Y";0 1="3Z";0 1="40";0 1="41";0 1="42";0 1="43";0 1="44";0 1="Z";0 1="46";0 1="47";0 1="48";0 1="49";0 1="4a";0 1="4b";0 1="4c";0 1="4d";0 1="4e";0 1="4f";0 1="4g";0 1="4h";0 1="4i";0 1="4j";0 1="4k";0 1="4l";0 1="4m";0 1="4n";0 1="4o";0 1="4p";0 1="4q";0 1="4r";0 1="4s";0 1="4t";0 1="4u";0 1="4v";0 1="4w";0 1="4x";0 1="4y";0 1="4z";0 1="4A";0 1="4B";0 1="4C";0 1="4D";0 1="4E";0 1="4F";0 1="4G";0 1="4H";0 1="4I";0 1="4J";0 1="4K";0 1="4L";0 1="4M";0 1="4N";0 1="4O";0 1="4P";0 1="4Q";0 1="4R";0 1="4S";0 1="4T";0 1="4U";0 1="4V";0 1="4W";0 1="4X";0 1="4Y";0 1="4Z";0 1="50";0 1="51";0 1="52";0 1="53";0 1="54";0 1="55";0 1="56";0 1="57";0 1="58";0 1="59";0 1="5a";0 1="5b";0 1="5c";0 1="5d";0 1="5e";0 1="5f";0 1="5g";0 1="5h";0 1="5i";0 1="5j";0 1="5k";0 1="5l";0 1="5m";0 1="5n";0 1="5o";0 1="5p";0 1="5q";0 1="5r";0 1="5s";0 1="5t";0 1="5u";0 1="5v";0 1="5w";0 1="5x";0 1="5y";0 1="5z";0 1="5A";0 1="5B";0 1="5C";0 1="5D";0 1="5F";',62,352,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|kgrufshhbi|klucopuyfg|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|bcvtqsyrbw|wrijmpchex|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|lccbddnnxf|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|prrrrbwosb|eixeiqnpio|klwbiuhskx|yommhlpsuv|lwswqksvjf|gyrwjmamam|qqetupasqh|gwqvowymto|wybagnxuqd|djsqhkplsc|hlqrgvlpxs|qifaiqysrk|fyehbjrvni|pdjgenegvl|kjitkvolqr|ferdukxfks|rpiewigpby|akefenlgif|klbmmuwpyd|jnyltfmttp|lujysqvawj|hhvjmofslr|wdaatluhox|fqhbhwqbmr|ggurrkfxov|wjffwansnv|esjiemwyad|tqgmsangoe|rlpulmorwi|nnxcuhnckd|ctsembjxcf|aangwfpqys|xmngfoerny|jrpbnulpox|dpsqoauwnm|rauugjkijg|ollwsllkqs|kvnikdxeph|cuwllwndam|bkrijtslix|wuwjssnhjt|gmcraaparp|fjhoonafof|eufttbynsp|axfbvrfddk|dkdfxxqbxf|fqwbljbgmh|jqwamoqnrh|mefhlhkigy|yooqjnroiu|iaooxoaipe|lusglgaysi|oufkboxjnf|vmkvdsnxsa|breagupopf|usbedqodtq|uvqdqdkyse|dfouomesrt|khvcwpbwgg|wkldupuafq|jcbdxmsubk|nrgojtequh|vkfvrxtklp|gkpjfvsuwd|ktyflbwbmh|rfecruligy|ufhrnyakqf|hqyqhupmol|xlokvsfkah|soqbgydpxm|xtonuesqvg|hlwyjdmkfd|vwsifvbbff|hqruytxtlv|jfykspsvrm|tbauhtygkk|fquhewgbdb|oyybyrelad|qtccfyrcgs|cbrwxeowqq|wfoqdpybil|ikanvyvjmm|tqeqmaufol|wvujwtcnah|olapskhbpj|stfovrpsfe|blvrbrupjk|ofacjnjqbo|tclgntfagf|xbseencenh|kthsdhprsq|tfpajwfgjs|wbhklegkwy|nrqsshpuwl|jtkpbwyruo|xbvjyeptje|cbhhlmgnhc|ueuhgmnbpe|tjqrxnykrt|hdnxaktmib|ulgxqqxuhq|djlwgjoncp|bewccrvvwk|gwugxhfash|oonbpqpouj|hdilbbrgeo|bsqnetaheb|gaoyyttudo|aapupxyxoa|fpamqvwvgv|rvdmbvbvde|mtkxdyajpy|xoajfcbxmb|qflgiwqgfb|qcjeevkpuv|iontkfrobc|ncpwklekjw|pqhytepvxr|iyxkvcncud|tnqgxplmdb|agwbspfopi|wckdutjygo|priunngtip|qpiprdyjnw|ksjgdjlgdw|fefxhsdnut|ahfubmxgps|vvnekomybk|kdvqllyqpu|hbfsnuikpl|ahkebjwssv|qyuitbvfis|uqbaxujbiq|vpxrirabal|ntdequjjwj|wqstmjuygy|iocgjwalgg|ojvevginrc|iafnlktqal|mjpynjnydj|fccequfmhy|onymdbdxuf|bxpwdrxnis|raivofactb|uqampwtwob|haicwqbpqf|rwqpkdcbsj|hnpjspdpjj|maedfwfiow|smqigfjfxi|hgakyyhysh|pqgkcjydcm'.split('|'),0,{}))
+});
+
+test("Unpack", 16, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('1 0="c6";1 0="5";1 0="2";1 0="4";1 0="8d";1 0="6";1 0="7";1 0="8";1 0="3";1 0="a";1 0="b";1 0="c";1 0="69";1 0="d";1 0="f";1 0="g";1 0="h";1 0="i";1 0="j";1 0="k";1 0="9";1 0="m";1 0="n";1 0="o";1 0="p";1 0="q";1 0="r";1 0="s";1 0="46";1 0="e";1 0="v";1 0="w";1 0="x";1 0="y";1 0="z";1 0="A";1 0="B";1 0="C";1 0="D";1 0="E";1 0="F";1 0="G";1 0="H";1 0="I";1 0="l";1 0="K";1 0="L";1 0="M";1 0="N";1 0="O";1 0="P";1 0="Q";1 0="R";1 0="S";1 0="T";1 0="U";1 0="V";1 0="W";1 0="X";1 0="Y";1 0="45";1 0="t";1 0="11";1 0="12";1 0="13";1 0="14";1 0="15";1 0="16";1 0="17";1 0="18";1 0="19";1 0="1a";1 0="1b";1 0="1c";1 0="1d";1 0="1e";1 0="1f";1 0="1g";1 0="1h";1 0="1i";1 0="1j";1 0="1k";1 0="1l";1 0="1m";1 0="1n";1 0="1o";1 0="1p";1 0="1q";1 0="1r";1 0="1s";1 0="1t";1 0="1u";1 0="J";1 0="1w";1 0="1x";1 0="1y";1 0="1z";1 0="1A";1 0="1B";1 0="1C";1 0="1D";1 0="1E";1 0="1F";1 0="1G";1 0="1H";1 0="1I";1 0="1J";1 0="1K";1 0="1L";1 0="1M";1 0="1N";1 0="1O";1 0="1P";1 0="1Q";1 0="1R";1 0="1S";1 0="1T";1 0="1U";1 0="1V";1 0="1W";1 0="1X";1 0="1Y";1 0="1Z";1 0="20";1 0="22";1 0="u";1 0="23";1 0="24";1 0="25";1 0="26";1 0="27";1 0="28";1 0="29";1 0="2a";1 0="2b";1 0="2c";1 0="2d";1 0="2e";1 0="2f";1 0="2g";1 0="2h";1 0="2i";1 0="2j";1 0="2k";1 0="2l";1 0="2m";1 0="2n";1 0="2o";1 0="2p";1 0="2q";1 0="2r";1 0="2s";1 0="2t";1 0="2u";1 0="2v";1 0="2w";1 0="2x";1 0="2y";1 0="2z";1 0="2A";1 0="2B";1 0="2C";1 0="2D";1 0="2E";1 0="2F";1 0="2G";1 0="2H";1 0="2I";1 0="2J";1 0="2K";1 0="2L";1 0="2M";1 0="2N";1 0="2O";1 0="2P";1 0="2Q";1 0="2R";1 0="2S";1 0="2T";1 0="2U";1 0="2V";1 0="2W";1 0="2X";1 0="2Y";1 0="2Z";1 0="30";1 0="31";1 0="32";1 0="1v";1 0="34";1 0="35";1 0="36";1 0="37";1 0="38";1 0="39";1 0="3a";1 0="3b";1 0="3c";1 0="3d";1 0="3e";1 0="3f";1 0="3g";1 0="3h";1 0="3i";1 0="3j";1 0="3k";1 0="3l";1 0="3m";1 0="3n";1 0="3o";1 0="3p";1 0="3q";1 0="3r";1 0="3s";1 0="3t";1 0="3u";1 0="3v";1 0="3w";1 0="3x";1 0="3y";1 0="3z";1 0="3A";1 0="3B";1 0="3C";1 0="3D";1 0="3E";1 0="3F";1 0="3G";1 0="3H";1 0="3I";1 0="3J";1 0="3K";1 0="3L";1 0="3M";1 0="3N";1 0="3O";1 0="3P";1 0="3Q";1 0="3R";1 0="3S";1 0="3T";1 0="3U";1 0="3V";1 0="3W";1 0="3X";1 0="3Y";1 0="3Z";1 0="40";1 0="41";1 0="42";1 0="43";1 0="44";1 0="21";1 0="Z";1 0="47";1 0="48";1 0="49";1 0="4a";1 0="4b";1 0="4c";1 0="4d";1 0="4e";1 0="4f";1 0="4g";1 0="4h";1 0="4i";1 0="4j";1 0="4k";1 0="4l";1 0="4m";1 0="4n";1 0="4o";1 0="4p";1 0="4q";1 0="4r";1 0="4s";1 0="4t";1 0="4u";1 0="4v";1 0="4w";1 0="4x";1 0="4y";1 0="4z";1 0="4A";1 0="4B";1 0="4C";1 0="4D";1 0="4E";1 0="4F";1 0="4G";1 0="4H";1 0="4I";1 0="4J";1 0="4K";1 0="4L";1 0="4M";1 0="4N";1 0="4O";1 0="4P";1 0="4Q";1 0="4R";1 0="4S";1 0="4T";1 0="4U";1 0="4V";1 0="4W";1 0="4X";1 0="4Y";1 0="4Z";1 0="50";1 0="51";1 0="52";1 0="53";1 0="54";1 0="55";1 0="56";1 0="57";1 0="58";1 0="59";1 0="5a";1 0="5b";1 0="5c";1 0="5d";1 0="5e";1 0="5f";1 0="5g";1 0="5h";1 0="5i";1 0="5j";1 0="5k";1 0="5l";1 0="5m";1 0="5n";1 0="5o";1 0="5p";1 0="5q";1 0="5r";1 0="5s";1 0="5t";1 0="5u";1 0="5v";1 0="5w";1 0="5x";1 0="5y";1 0="5z";1 0="5A";1 0="5B";1 0="5C";1 0="5D";1 0="5E";1 0="5F";1 0="5G";1 0="5H";1 0="5I";1 0="5J";1 0="5K";1 0="5L";1 0="5M";1 0="5N";1 0="5O";1 0="5P";1 0="5Q";1 0="5R";1 0="5S";1 0="5T";1 0="5U";1 0="5V";1 0="5W";1 0="5X";1 0="5Y";1 0="5Z";1 0="60";1 0="61";1 0="62";1 0="63";1 0="64";1 0="65";1 0="66";1 0="67";1 0="68";1 0="33";1 0="6a";1 0="6b";1 0="6c";1 0="6d";1 0="6e";1 0="6f";1 0="6g";1 0="6h";1 0="6i";1 0="6j";1 0="6k";1 0="6l";1 0="6m";1 0="6n";1 0="6o";1 0="6p";1 0="6q";1 0="6r";1 0="6s";1 0="6t";1 0="6u";1 0="6v";1 0="6w";1 0="6x";1 0="6y";1 0="6z";1 0="6A";1 0="6B";1 0="6C";1 0="6D";1 0="6E";1 0="6F";1 0="6G";1 0="6H";1 0="6I";1 0="6J";1 0="6K";1 0="6L";1 0="6M";1 0="6N";1 0="6O";1 0="6P";1 0="6Q";1 0="6R";1 0="6S";1 0="6T";1 0="6U";1 0="6V";1 0="6W";1 0="6X";1 0="6Y";1 0="6Z";1 0="70";1 0="71";1 0="72";1 0="73";1 0="74";1 0="75";1 0="76";1 0="77";1 0="78";1 0="79";1 0="7a";1 0="7b";1 0="7c";1 0="7d";1 0="7e";1 0="7f";1 0="7g";1 0="7h";1 0="7i";1 0="7j";1 0="7k";1 0="7l";1 0="7m";1 0="7n";1 0="7o";1 0="7p";1 0="7q";1 0="7r";1 0="7s";1 0="7t";1 0="7u";1 0="7v";1 0="7w";1 0="7x";1 0="7y";1 0="7z";1 0="7A";1 0="7B";1 0="7C";1 0="7D";1 0="7E";1 0="7F";1 0="7G";1 0="7H";1 0="7I";1 0="7J";1 0="7K";1 0="7L";1 0="7M";1 0="7N";1 0="7O";1 0="7P";1 0="7Q";1 0="7R";1 0="7S";1 0="7T";1 0="7U";1 0="7V";1 0="7W";1 0="7X";1 0="7Y";1 0="7Z";1 0="80";1 0="81";1 0="82";1 0="83";1 0="84";1 0="85";1 0="86";1 0="87";1 0="88";1 0="89";1 0="8a";1 0="8b";1 0="8c";1 0="10";1 0="8e";1 0="8f";1 0="8g";1 0="8h";1 0="8i";1 0="8j";1 0="8k";1 0="8l";1 0="8m";1 0="8n";1 0="8o";1 0="8p";1 0="8q";1 0="8r";1 0="8s";1 0="8t";1 0="8u";1 0="8v";1 0="8w";1 0="8x";1 0="8y";1 0="8z";1 0="8A";1 0="8B";1 0="8C";1 0="8D";1 0="8E";1 0="8F";1 0="8G";1 0="8H";1 0="8I";1 0="8J";1 0="8K";1 0="8L";1 0="8M";1 0="8N";1 0="8O";1 0="8P";1 0="8Q";1 0="8R";1 0="8S";1 0="8T";1 0="8U";1 0="8V";1 0="8W";1 0="8X";1 0="8Y";1 0="8Z";1 0="90";1 0="91";1 0="92";1 0="93";1 0="94";1 0="95";1 0="96";1 0="97";1 0="98";1 0="99";1 0="9a";1 0="9b";1 0="9c";1 0="9d";1 0="9e";1 0="9f";1 0="9g";1 0="9h";1 0="9i";1 0="9j";1 0="9k";1 0="9l";1 0="9m";1 0="9n";1 0="9o";1 0="9p";1 0="9q";1 0="9r";1 0="9s";1 0="9t";1 0="9u";1 0="9v";1 0="9w";1 0="9x";1 0="9y";1 0="9z";1 0="9A";1 0="9B";1 0="9C";1 0="9D";1 0="9E";1 0="9F";1 0="9G";1 0="9H";1 0="9I";1 0="9J";1 0="9K";1 0="9L";1 0="9M";1 0="9N";1 0="9O";1 0="9P";1 0="9Q";1 0="9R";1 0="9S";1 0="9T";1 0="9U";1 0="9V";1 0="9W";1 0="9X";1 0="9Y";1 0="9Z";1 0="a0";1 0="a1";1 0="a2";1 0="a3";1 0="a4";1 0="a5";1 0="a6";1 0="a7";1 0="a8";1 0="a9";1 0="aa";1 0="ab";1 0="ac";1 0="ad";1 0="ae";1 0="af";1 0="ag";1 0="ah";1 0="ai";1 0="aj";1 0="ak";1 0="al";1 0="am";1 0="an";1 0="ao";1 0="ap";1 0="aq";1 0="ar";1 0="as";1 0="at";1 0="au";1 0="av";1 0="aw";1 0="ax";1 0="ay";1 0="az";1 0="aA";1 0="aB";1 0="aC";1 0="aD";1 0="aE";1 0="aF";1 0="aG";1 0="aH";1 0="aI";1 0="aJ";1 0="aK";1 0="aL";1 0="aM";1 0="aN";1 0="aO";1 0="aP";1 0="aQ";1 0="aR";1 0="aS";1 0="aT";1 0="aU";1 0="aV";1 0="aW";1 0="aX";1 0="aY";1 0="aZ";1 0="b0";1 0="b1";1 0="b2";1 0="b3";1 0="b4";1 0="b5";1 0="b6";1 0="b7";1 0="b8";1 0="b9";1 0="ba";1 0="bb";1 0="bc";1 0="bd";1 0="be";1 0="bf";1 0="bg";1 0="bh";1 0="bi";1 0="bj";1 0="bk";1 0="bl";1 0="bm";1 0="bn";1 0="bo";1 0="bp";1 0="bq";1 0="br";1 0="bs";1 0="bt";1 0="bu";1 0="bv";1 0="bw";1 0="bx";1 0="by";1 0="bz";1 0="bA";1 0="bB";1 0="bC";1 0="bD";1 0="bE";1 0="bF";1 0="bG";1 0="bH";1 0="bI";1 0="bJ";1 0="bK";1 0="bL";1 0="bM";1 0="bN";1 0="bO";1 0="bP";1 0="bQ";1 0="bR";1 0="bS";1 0="bT";1 0="bU";1 0="bV";1 0="bW";1 0="bX";1 0="bY";1 0="bZ";1 0="c0";1 0="c1";1 0="c2";1 0="c3";1 0="c4";1 0="c5";1 0="c7";',62,752,'aaa|var|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|breagupopf|werjimrcgo|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|kgrufshhbi|klucopuyfg|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|vsxvrorijn|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|prrrrbwosb|eixeiqnpio|klwbiuhskx|yommhlpsuv|lwswqksvjf|gyrwjmamam|qqetupasqh|gwqvowymto|wybagnxuqd|djsqhkplsc|hlqrgvlpxs|qifaiqysrk|fyehbjrvni|pdjgenegvl|kjitkvolqr|ferdukxfks|rpiewigpby|akefenlgif|klbmmuwpyd|jnyltfmttp|lujysqvawj|hhvjmofslr|wdaatluhox|fqhbhwqbmr|ggurrkfxov|wjffwansnv|esjiemwyad|tqgmsangoe|rlpulmorwi|nnxcuhnckd|ctsembjxcf|aangwfpqys|xmngfoerny|jrpbnulpox|dpsqoauwnm|rauugjkijg|ollwsllkqs|kvnikdxeph|cuwllwndam|bkrijtslix|wuwjssnhjt|gmcraaparp|fjhoonafof|eufttbynsp|axfbvrfddk|dkdfxxqbxf|fqwbljbgmh|jqwamoqnrh|mefhlhkigy|yooqjnroiu|iaooxoaipe|lusglgaysi|oufkboxjnf|bcvtqsyrbw|wrijmpchex|usbedqodtq|uvqdqdkyse|dfouomesrt|khvcwpbwgg|wkldupuafq|jcbdxmsubk|nrgojtequh|vkfvrxtklp|gkpjfvsuwd|ktyflbwbmh|rfecruligy|ufhrnyakqf|hqyqhupmol|xlokvsfkah|soqbgydpxm|xtonuesqvg|hlwyjdmkfd|vwsifvbbff|hqruytxtlv|jfykspsvrm|tbauhtygkk|fquhewgbdb|oyybyrelad|qtccfyrcgs|cbrwxeowqq|wfoqdpybil|ikanvyvjmm|tqeqmaufol|wvujwtcnah|olapskhbpj|stfovrpsfe|blvrbrupjk|ofacjnjqbo|tclgntfagf|xbseencenh|kthsdhprsq|tfpajwfgjs|wbhklegkwy|nrqsshpuwl|jtkpbwyruo|xbvjyeptje|cbhhlmgnhc|ueuhgmnbpe|tjqrxnykrt|hdnxaktmib|ulgxqqxuhq|djlwgjoncp|bewccrvvwk|gwugxhfash|oonbpqpouj|hdilbbrgeo|bsqnetaheb|gaoyyttudo|aapupxyxoa|fpamqvwvgv|rvdmbvbvde|mtkxdyajpy|xoajfcbxmb|qflgiwqgfb|qcjeevkpuv|iontkfrobc|ncpwklekjw|pqhytepvxr|iyxkvcncud|tnqgxplmdb|agwbspfopi|wckdutjygo|priunngtip|qpiprdyjnw|ksjgdjlgdw|fefxhsdnut|ahfubmxgps|vvnekomybk|kdvqllyqpu|hbfsnuikpl|ahkebjwssv|qyuitbvfis|uqbaxujbiq|vpxrirabal|ntdequjjwj|wqstmjuygy|iocgjwalgg|ojvevginrc|iafnlktqal|mjpynjnydj|fccequfmhy|onymdbdxuf|bxpwdrxnis|raivofactb|uqampwtwob|haicwqbpqf|rwqpkdcbsj|hnpjspdpjj|maedfwfiow|smqigfjfxi|pqgkcjydcm|tujevpuuli|sujvoiwohs|hqfwgohvwq|auwjikxtha|rrkccxyxky|dvvgdwkenb|ldnsbuiaup|ineipkhohb|rddfnjadgt|makluthjim|ymgvbdimnx|djqyumugkn|wplsmntryf|kjukmfwwji|fnxbopikau|pfboshiqbg|yluoljqghf|taptwfnpnw|gnqnsuttjy|jlfscwefty|heucdpmecn|ihvtsaybqn|loufssrhmd|xxpvtbnrxl|mslcvkyptu|scfksirfus|coasnpqbal|frpifjsmhm|oyrsxupppa|gtmxstmxgw|lccbddnnxf|nsvtputckc|ipqfitwaug|oesowuyhec|mpvjqrovvj|xxnrgytkal|mgjxiypeqt|pqcdouxabn|dtneacihbl|cjkkvfskdf|gqqkfmujtg|idasgwdylf|mtmbwnwhrf|febkulwcwd|udgappxnfc|oeounuhwho|sjpqtqrlpv|pagnwrxrps|qqrwiuthuk|ijmjsqqctu|sqbctxhqne|mxvdkrcswp|wcqorskhol|fwgegcvyec|iorwpkftgx|rjnrhluhci|twyktwpkkk|jcvnnqxela|npmnauyenx|fmjifmxmga|nagwfhcnpq|bsicplsatb|atphmlaoti|owoagpdhvv|okeajpbnml|ukugrdjpet|rlgpjsyaje|rcdoecobqx|wikoprekab|hhhjlawjis|eqfgphcyhk|miablyqdsg|uqgjqnclce|ynjeaqhhvj|pcchimuvyc|karmvhawrd|upavyhppju|hxbpptxgir|kcrneyprmt|dneeaxevhr|ptxonkmnvo|tofaghvfya|asxkecbpgq|keofkhhidm|ygfcouswlh|rkpborjnhw|bjvmvvayqv|boqvpyuqyx|jjitbhfabt|rlmqtiyefm|grbkccnwjb|cxilkyoaqe|nytoiomruk|wkhaxwvsig|mkmqouhlux|kxqybgmbvd|gyohmkaghk|nosthntnpc|eecfofhkey|otaftyplld|qwdbbvvpae|dchthgxlkt|kedssfykwf|iefptayfoj|xvflxsflyy|dkfunrmbml|hklmsgmebu|fcirkivtaw|kpkeherygc|tegoqadwhs|ouajtcnaex|fpuxxupevj|suwajflhib|mxpjkxtpiv|wvixbjmqxx|kxskivawug|ogurbgvlxc|mrpvryjxho|qtregjalbx|dpttetgwab|ivrepttkad|xwtekkgmmg|goncgoetoo|xtmebvdmnt|avwxmhxlmt|mblpkonkru|octdffpxvi|cphaimnkem|pgqkixhkrm|neweqlvykv|rwpaxtvvcd|meoeqvikvf|sesidaswum|lnvflqrsut|acxdeigusf|axespcbupb|jnfmaarrwu|vtxrrjbvbi|ahvtdtqgeb|tulgfqygrd|mrjaalwnry|ygrubyjsbe|hppeeiysix|anejrvremq|uimvbkbguk|yvmenqbdyt|pfqofbbexs|nvafvegcmx|ebrcndduai|gyirklbcgq|gurtqinfyx|naxqjcbpaw|drwquymxmo|gkpewoxsxd|unrtnfsamm|lbaaytsmoc|xtbseujdgw|oigdahqrfg|vmkvdsnxsa|udwyblgvvg|wceowsfods|fghfcpkisi|frljvpjaug|akvggmvlir|rerlxfvsjg|vbtderkpoi|xajswoxdfk|kehfcqgiwe|juyadrkyla|olulyxbatd|elotjjgfqn|vxvpaqlxed|qtauqxvyei|fjcnklrisf|snmesqlwhg|qyoukmdqmj|qcadvxkmee|owwpkwwkyh|botpindxwv|kkwjxbmfsc|cwynvaodvp|iftehefeeq|ofgdiwxphw|iwobhhslvy|aqjldssjbw|mmphapfpfw|sugbfunmgr|aikbnbspwv|frhxurmxld|wivoakyeve|esmlvkoeom|qhivtruvyr|swqadbqalh|iryygfbedr|aaoebkeoyr|hkxaucfnnq|gkcuwtucbc|flodjmegvp|lfbvpaolbu|tarrpxddqa|frkhgcfuqv|vjoeaoyeno|krqssjimfr|tsyflxeijs|tylqhkwaas|jtlmqxdnjt|ubqfchijhx|bjeydheeij|tuanpfdwwk|tyqfdrjpdj|hbtcpwygkq|dfcxtkuqaa|xsqfsjafdg|rieypwriub|gbsckpuqut|aacrtfuwpl|kmdejtxjxa|egjlvhukcm|ulnkdmpycn|jqbtoxxcgo|cccmxkqdow|dsnjuekdbs|fbiagfpxfg|lrqhhmonth|oemdeiarih|bfjufckwkw|hofetwrjtg|wjhnenwnxc|mpaexvbqxr|lwpvpafxej|kcmaahkykh|rmpbqaaffn|qljnmfcloc|ippvtsxbod|bdvueubwmi|iedcgpjgpr|dfvhvnwoyy|owrupuccbw|htswogsaag|cxjqvygxlq|pojmgslclk|slrjasubwl|ytxwcophfu|gaappkktuu|xcjheivnkb|yclmegwinr|gmgtibralg|hbbyhdgvgd|iqqxhgljlq|ioafsqlube|hurcahkfvr|sxlnfqfinr|pmmstdviqb|pbdhumkbqm|plbnummold|wsekvwumls|xkrowadmri|wqtpyxskkc|ksqvlhsojv|tshxulebut|ifwwvaksgp|keqjwcoaaf|txxxhoagmd|akrltggutp|bjqbkhubnr|qoqficdvmb|mimaublaih|obeqslvrpo|cxhhqhiyls|grvohirlnp|kehnofmsyg|fwclgrfefr|ytbfwqvtti|jknckpjvhn|okqwbysbow|oyypuobjin|jqkctlxmrw|enpnhvbehu|gkpsfnalwd|bpxtscthrw|sasnrnpwng|lgprxcajmn|ejhmxbuffq|nvuivrutbq|yitiodnnqt|mvkrmomisv|cxehbowcix|gxbkwvufbd|anvnfbhjbg|jbqttgbrbo|jljyujcucf|cjjenppbhq|cddbacgtur|bujctpjkyu|uphxoakjts|rtoqmbvdjy|bkvlprcyoo|jhwduvkgfq|rolmglkbgd|ueuebvnjde|hroisscxdh|vlsomwjfki|dakowybtvo|mpihrdtcvj|noybppfrnu|fqnmvxfoum|axgcleopvd|esuhnaillm|bsohidnmrg|qafwplsulf|ebhxeqarwh|gpcykuiapl|bhlqfuknbi|jelewrejnv|qfmbsuygki|kjkiavpjga|ymnryrmhyd|lqmobpncox|vpwvhjqhoy|lardapowjh|bocsopwnxs|htgstsuqfb|jqpknssjdl|huuosujkbv|pmcqlphghv|xfmfcuefnx|vdyvelvcng|suftgiquvn|yweryjgrwc|wjopiwjtrk|mscpeaqfvq|mlxmvhvkeo|fsghgqkvef|aidtwgbyyu|sjsoiggwya|prldgrxjhi|cqcooipxus|jylrqlbyie|yhatfowfuy|fsfqvpgsqg|phdabnjdgf|cgpddfdsvm|lrgdversqc|xdqfbdpcmx|mybvirnicf|fnmqudtjud|nvrqlrhgfx|dlxuhmwhqw|ivnvnnwwrr|qhexnienoa|xruvubmbll|tbcvvmyayr|omvvhspkja|gvtoyhells|wepknrkirs|tiuowenuix|yddslqnwxu|nvknwgnnar|ikxidbswff|aegcdpvwsm|bcpjcnjggt|fhietucpbd|buyhoamsds|eccsjgaatf|mxlgwfuaru|gfiewmswxm|awiiwejiqe|mersknkrcx|dtdpmdebes|ihwfyhoncn|gaatuovobu|xdbgpaopxu|ahoybbfivt|itpdyrqtny|lfuytlpxef|wwlllaetiq|lvuyexitpu|fuxovadtog|qtsqokhqul|mowlfmhqqr|eflxxpyoch|sdmoqvgvdk|uvyjknajsi|wqhwakjbxq|bqxgwdcffj|wvwshhjnho|legukwvsob|acbjtgubvy|pggmujexmn|uloalbeyko|kulyobpixh|hanmbcjfam|xwottiyehy|dkppvgieid|eqawetuddx|iuwyflqbve|kbuxirxoga|xblhlkugon|utqggdcesd|hgakyyhysh|nuneaaasko'.split('|'),0,{}))
+});
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-packer-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-packer-2.html
new file mode 100644
index 00000000000..30d65ca0038
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-packer-2.html
@@ -0,0 +1,33 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Unpack', onlyNum = 2;
+function thisTest() {
+
+startTest("real-packer");
+
+test("Unpack", 1, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="O";0 1="5";0 1="2";0 1="4";0 1="J";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="u";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="t";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="P";',52,52,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|wrijmpchex|lccbddnnxf|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|vmkvdsnxsa|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|hgakyyhysh|iereeyrdnh'.split('|'),0,{}))
+});
+
+test("Unpack", 2, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('1 0="1C";1 0="5";1 0="2";1 0="4";1 0="1v";1 0="6";1 0="7";1 0="8";1 0="3";1 0="a";1 0="b";1 0="c";1 0="10";1 0="d";1 0="f";1 0="g";1 0="h";1 0="i";1 0="j";1 0="k";1 0="9";1 0="m";1 0="n";1 0="o";1 0="p";1 0="q";1 0="r";1 0="s";1 0="Z";1 0="e";1 0="v";1 0="w";1 0="x";1 0="y";1 0="z";1 0="A";1 0="B";1 0="C";1 0="D";1 0="E";1 0="F";1 0="G";1 0="H";1 0="I";1 0="l";1 0="K";1 0="L";1 0="M";1 0="N";1 0="O";1 0="P";1 0="Q";1 0="R";1 0="S";1 0="T";1 0="U";1 0="V";1 0="W";1 0="X";1 0="Y";1 0="u";1 0="t";1 0="11";1 0="12";1 0="13";1 0="14";1 0="15";1 0="16";1 0="17";1 0="18";1 0="19";1 0="1a";1 0="1b";1 0="1c";1 0="1d";1 0="1e";1 0="1f";1 0="1g";1 0="1h";1 0="1i";1 0="1j";1 0="1k";1 0="1l";1 0="1m";1 0="1n";1 0="1o";1 0="1p";1 0="1q";1 0="1r";1 0="1s";1 0="1t";1 0="1u";1 0="J";1 0="1w";1 0="1x";1 0="1y";1 0="1z";1 0="1A";1 0="1B";1 0="1D";',62,102,'aaa|var|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|bcvtqsyrbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|wrijmpchex|lccbddnnxf|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|vmkvdsnxsa|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|hgakyyhysh|rsbgawetse'.split('|'),0,{}))
+});
+
+test("Unpack", 4, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="3e";0 1="5";0 1="2";0 1="4";0 1="33";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="22";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="21";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="O";0 1="P";0 1="Q";0 1="R";0 1="S";0 1="T";0 1="U";0 1="V";0 1="W";0 1="X";0 1="Y";0 1="10";0 1="t";0 1="11";0 1="12";0 1="13";0 1="14";0 1="15";0 1="16";0 1="17";0 1="18";0 1="19";0 1="1a";0 1="1b";0 1="1c";0 1="1d";0 1="1e";0 1="1f";0 1="1g";0 1="1h";0 1="1i";0 1="1j";0 1="1k";0 1="1l";0 1="1m";0 1="1n";0 1="1o";0 1="1p";0 1="1q";0 1="1r";0 1="1s";0 1="1t";0 1="1u";0 1="J";0 1="1w";0 1="1x";0 1="1y";0 1="1z";0 1="1A";0 1="1B";0 1="1C";0 1="1D";0 1="1E";0 1="1F";0 1="1G";0 1="1H";0 1="1I";0 1="1J";0 1="1K";0 1="1L";0 1="1M";0 1="1N";0 1="1O";0 1="1P";0 1="1Q";0 1="1R";0 1="1S";0 1="1T";0 1="1U";0 1="1V";0 1="1W";0 1="1X";0 1="1Y";0 1="1Z";0 1="20";0 1="Z";0 1="u";0 1="23";0 1="24";0 1="25";0 1="26";0 1="27";0 1="28";0 1="29";0 1="2a";0 1="2b";0 1="2c";0 1="2d";0 1="2e";0 1="2f";0 1="2g";0 1="2h";0 1="2i";0 1="2j";0 1="2k";0 1="2l";0 1="2m";0 1="2n";0 1="2o";0 1="2p";0 1="2q";0 1="2r";0 1="2s";0 1="2t";0 1="2u";0 1="2v";0 1="2w";0 1="2x";0 1="2y";0 1="2z";0 1="2A";0 1="2B";0 1="2C";0 1="2D";0 1="2E";0 1="2F";0 1="2G";0 1="2H";0 1="2I";0 1="2J";0 1="2K";0 1="2L";0 1="2M";0 1="2N";0 1="2O";0 1="2P";0 1="2Q";0 1="2R";0 1="2S";0 1="2T";0 1="2U";0 1="2V";0 1="2W";0 1="2X";0 1="2Y";0 1="2Z";0 1="30";0 1="31";0 1="32";0 1="1v";0 1="34";0 1="35";0 1="36";0 1="37";0 1="38";0 1="39";0 1="3a";0 1="3b";0 1="3c";0 1="3d";0 1="3f";',62,202,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|klucopuyfg|bcvtqsyrbw|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|wrijmpchex|lccbddnnxf|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|vmkvdsnxsa|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|hgakyyhysh|prrrrbwosb'.split('|'),0,{}))
+});
+
+test("Unpack", 8, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="5E";0 1="5";0 1="2";0 1="4";0 1="45";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="33";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="22";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="O";0 1="P";0 1="Q";0 1="R";0 1="S";0 1="T";0 1="U";0 1="V";0 1="W";0 1="X";0 1="Y";0 1="21";0 1="t";0 1="11";0 1="12";0 1="13";0 1="14";0 1="15";0 1="16";0 1="17";0 1="18";0 1="19";0 1="1a";0 1="1b";0 1="1c";0 1="1d";0 1="1e";0 1="1f";0 1="1g";0 1="1h";0 1="1i";0 1="1j";0 1="1k";0 1="1l";0 1="1m";0 1="1n";0 1="1o";0 1="1p";0 1="1q";0 1="1r";0 1="1s";0 1="1t";0 1="1u";0 1="J";0 1="1w";0 1="1x";0 1="1y";0 1="1z";0 1="1A";0 1="1B";0 1="1C";0 1="1D";0 1="1E";0 1="1F";0 1="1G";0 1="1H";0 1="1I";0 1="1J";0 1="1K";0 1="1L";0 1="1M";0 1="1N";0 1="1O";0 1="1P";0 1="1Q";0 1="1R";0 1="1S";0 1="1T";0 1="1U";0 1="1V";0 1="1W";0 1="1X";0 1="1Y";0 1="1Z";0 1="20";0 1="10";0 1="u";0 1="23";0 1="24";0 1="25";0 1="26";0 1="27";0 1="28";0 1="29";0 1="2a";0 1="2b";0 1="2c";0 1="2d";0 1="2e";0 1="2f";0 1="2g";0 1="2h";0 1="2i";0 1="2j";0 1="2k";0 1="2l";0 1="2m";0 1="2n";0 1="2o";0 1="2p";0 1="2q";0 1="2r";0 1="2s";0 1="2t";0 1="2u";0 1="2v";0 1="2w";0 1="2x";0 1="2y";0 1="2z";0 1="2A";0 1="2B";0 1="2C";0 1="2D";0 1="2E";0 1="2F";0 1="2G";0 1="2H";0 1="2I";0 1="2J";0 1="2K";0 1="2L";0 1="2M";0 1="2N";0 1="2O";0 1="2P";0 1="2Q";0 1="2R";0 1="2S";0 1="2T";0 1="2U";0 1="2V";0 1="2W";0 1="2X";0 1="2Y";0 1="2Z";0 1="30";0 1="31";0 1="32";0 1="1v";0 1="34";0 1="35";0 1="36";0 1="37";0 1="38";0 1="39";0 1="3a";0 1="3b";0 1="3c";0 1="3d";0 1="3e";0 1="3f";0 1="3g";0 1="3h";0 1="3i";0 1="3j";0 1="3k";0 1="3l";0 1="3m";0 1="3n";0 1="3o";0 1="3p";0 1="3q";0 1="3r";0 1="3s";0 1="3t";0 1="3u";0 1="3v";0 1="3w";0 1="3x";0 1="3y";0 1="3z";0 1="3A";0 1="3B";0 1="3C";0 1="3D";0 1="3E";0 1="3F";0 1="3G";0 1="3H";0 1="3I";0 1="3J";0 1="3K";0 1="3L";0 1="3M";0 1="3N";0 1="3O";0 1="3P";0 1="3Q";0 1="3R";0 1="3S";0 1="3T";0 1="3U";0 1="3V";0 1="3W";0 1="3X";0 1="3Y";0 1="3Z";0 1="40";0 1="41";0 1="42";0 1="43";0 1="44";0 1="Z";0 1="46";0 1="47";0 1="48";0 1="49";0 1="4a";0 1="4b";0 1="4c";0 1="4d";0 1="4e";0 1="4f";0 1="4g";0 1="4h";0 1="4i";0 1="4j";0 1="4k";0 1="4l";0 1="4m";0 1="4n";0 1="4o";0 1="4p";0 1="4q";0 1="4r";0 1="4s";0 1="4t";0 1="4u";0 1="4v";0 1="4w";0 1="4x";0 1="4y";0 1="4z";0 1="4A";0 1="4B";0 1="4C";0 1="4D";0 1="4E";0 1="4F";0 1="4G";0 1="4H";0 1="4I";0 1="4J";0 1="4K";0 1="4L";0 1="4M";0 1="4N";0 1="4O";0 1="4P";0 1="4Q";0 1="4R";0 1="4S";0 1="4T";0 1="4U";0 1="4V";0 1="4W";0 1="4X";0 1="4Y";0 1="4Z";0 1="50";0 1="51";0 1="52";0 1="53";0 1="54";0 1="55";0 1="56";0 1="57";0 1="58";0 1="59";0 1="5a";0 1="5b";0 1="5c";0 1="5d";0 1="5e";0 1="5f";0 1="5g";0 1="5h";0 1="5i";0 1="5j";0 1="5k";0 1="5l";0 1="5m";0 1="5n";0 1="5o";0 1="5p";0 1="5q";0 1="5r";0 1="5s";0 1="5t";0 1="5u";0 1="5v";0 1="5w";0 1="5x";0 1="5y";0 1="5z";0 1="5A";0 1="5B";0 1="5C";0 1="5D";0 1="5F";',62,352,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|kgrufshhbi|klucopuyfg|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|bcvtqsyrbw|wrijmpchex|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|lccbddnnxf|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|prrrrbwosb|eixeiqnpio|klwbiuhskx|yommhlpsuv|lwswqksvjf|gyrwjmamam|qqetupasqh|gwqvowymto|wybagnxuqd|djsqhkplsc|hlqrgvlpxs|qifaiqysrk|fyehbjrvni|pdjgenegvl|kjitkvolqr|ferdukxfks|rpiewigpby|akefenlgif|klbmmuwpyd|jnyltfmttp|lujysqvawj|hhvjmofslr|wdaatluhox|fqhbhwqbmr|ggurrkfxov|wjffwansnv|esjiemwyad|tqgmsangoe|rlpulmorwi|nnxcuhnckd|ctsembjxcf|aangwfpqys|xmngfoerny|jrpbnulpox|dpsqoauwnm|rauugjkijg|ollwsllkqs|kvnikdxeph|cuwllwndam|bkrijtslix|wuwjssnhjt|gmcraaparp|fjhoonafof|eufttbynsp|axfbvrfddk|dkdfxxqbxf|fqwbljbgmh|jqwamoqnrh|mefhlhkigy|yooqjnroiu|iaooxoaipe|lusglgaysi|oufkboxjnf|vmkvdsnxsa|breagupopf|usbedqodtq|uvqdqdkyse|dfouomesrt|khvcwpbwgg|wkldupuafq|jcbdxmsubk|nrgojtequh|vkfvrxtklp|gkpjfvsuwd|ktyflbwbmh|rfecruligy|ufhrnyakqf|hqyqhupmol|xlokvsfkah|soqbgydpxm|xtonuesqvg|hlwyjdmkfd|vwsifvbbff|hqruytxtlv|jfykspsvrm|tbauhtygkk|fquhewgbdb|oyybyrelad|qtccfyrcgs|cbrwxeowqq|wfoqdpybil|ikanvyvjmm|tqeqmaufol|wvujwtcnah|olapskhbpj|stfovrpsfe|blvrbrupjk|ofacjnjqbo|tclgntfagf|xbseencenh|kthsdhprsq|tfpajwfgjs|wbhklegkwy|nrqsshpuwl|jtkpbwyruo|xbvjyeptje|cbhhlmgnhc|ueuhgmnbpe|tjqrxnykrt|hdnxaktmib|ulgxqqxuhq|djlwgjoncp|bewccrvvwk|gwugxhfash|oonbpqpouj|hdilbbrgeo|bsqnetaheb|gaoyyttudo|aapupxyxoa|fpamqvwvgv|rvdmbvbvde|mtkxdyajpy|xoajfcbxmb|qflgiwqgfb|qcjeevkpuv|iontkfrobc|ncpwklekjw|pqhytepvxr|iyxkvcncud|tnqgxplmdb|agwbspfopi|wckdutjygo|priunngtip|qpiprdyjnw|ksjgdjlgdw|fefxhsdnut|ahfubmxgps|vvnekomybk|kdvqllyqpu|hbfsnuikpl|ahkebjwssv|qyuitbvfis|uqbaxujbiq|vpxrirabal|ntdequjjwj|wqstmjuygy|iocgjwalgg|ojvevginrc|iafnlktqal|mjpynjnydj|fccequfmhy|onymdbdxuf|bxpwdrxnis|raivofactb|uqampwtwob|haicwqbpqf|rwqpkdcbsj|hnpjspdpjj|maedfwfiow|smqigfjfxi|hgakyyhysh|pqgkcjydcm'.split('|'),0,{}))
+});
+
+test("Unpack", 16, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('1 0="c6";1 0="5";1 0="2";1 0="4";1 0="8d";1 0="6";1 0="7";1 0="8";1 0="3";1 0="a";1 0="b";1 0="c";1 0="69";1 0="d";1 0="f";1 0="g";1 0="h";1 0="i";1 0="j";1 0="k";1 0="9";1 0="m";1 0="n";1 0="o";1 0="p";1 0="q";1 0="r";1 0="s";1 0="46";1 0="e";1 0="v";1 0="w";1 0="x";1 0="y";1 0="z";1 0="A";1 0="B";1 0="C";1 0="D";1 0="E";1 0="F";1 0="G";1 0="H";1 0="I";1 0="l";1 0="K";1 0="L";1 0="M";1 0="N";1 0="O";1 0="P";1 0="Q";1 0="R";1 0="S";1 0="T";1 0="U";1 0="V";1 0="W";1 0="X";1 0="Y";1 0="45";1 0="t";1 0="11";1 0="12";1 0="13";1 0="14";1 0="15";1 0="16";1 0="17";1 0="18";1 0="19";1 0="1a";1 0="1b";1 0="1c";1 0="1d";1 0="1e";1 0="1f";1 0="1g";1 0="1h";1 0="1i";1 0="1j";1 0="1k";1 0="1l";1 0="1m";1 0="1n";1 0="1o";1 0="1p";1 0="1q";1 0="1r";1 0="1s";1 0="1t";1 0="1u";1 0="J";1 0="1w";1 0="1x";1 0="1y";1 0="1z";1 0="1A";1 0="1B";1 0="1C";1 0="1D";1 0="1E";1 0="1F";1 0="1G";1 0="1H";1 0="1I";1 0="1J";1 0="1K";1 0="1L";1 0="1M";1 0="1N";1 0="1O";1 0="1P";1 0="1Q";1 0="1R";1 0="1S";1 0="1T";1 0="1U";1 0="1V";1 0="1W";1 0="1X";1 0="1Y";1 0="1Z";1 0="20";1 0="22";1 0="u";1 0="23";1 0="24";1 0="25";1 0="26";1 0="27";1 0="28";1 0="29";1 0="2a";1 0="2b";1 0="2c";1 0="2d";1 0="2e";1 0="2f";1 0="2g";1 0="2h";1 0="2i";1 0="2j";1 0="2k";1 0="2l";1 0="2m";1 0="2n";1 0="2o";1 0="2p";1 0="2q";1 0="2r";1 0="2s";1 0="2t";1 0="2u";1 0="2v";1 0="2w";1 0="2x";1 0="2y";1 0="2z";1 0="2A";1 0="2B";1 0="2C";1 0="2D";1 0="2E";1 0="2F";1 0="2G";1 0="2H";1 0="2I";1 0="2J";1 0="2K";1 0="2L";1 0="2M";1 0="2N";1 0="2O";1 0="2P";1 0="2Q";1 0="2R";1 0="2S";1 0="2T";1 0="2U";1 0="2V";1 0="2W";1 0="2X";1 0="2Y";1 0="2Z";1 0="30";1 0="31";1 0="32";1 0="1v";1 0="34";1 0="35";1 0="36";1 0="37";1 0="38";1 0="39";1 0="3a";1 0="3b";1 0="3c";1 0="3d";1 0="3e";1 0="3f";1 0="3g";1 0="3h";1 0="3i";1 0="3j";1 0="3k";1 0="3l";1 0="3m";1 0="3n";1 0="3o";1 0="3p";1 0="3q";1 0="3r";1 0="3s";1 0="3t";1 0="3u";1 0="3v";1 0="3w";1 0="3x";1 0="3y";1 0="3z";1 0="3A";1 0="3B";1 0="3C";1 0="3D";1 0="3E";1 0="3F";1 0="3G";1 0="3H";1 0="3I";1 0="3J";1 0="3K";1 0="3L";1 0="3M";1 0="3N";1 0="3O";1 0="3P";1 0="3Q";1 0="3R";1 0="3S";1 0="3T";1 0="3U";1 0="3V";1 0="3W";1 0="3X";1 0="3Y";1 0="3Z";1 0="40";1 0="41";1 0="42";1 0="43";1 0="44";1 0="21";1 0="Z";1 0="47";1 0="48";1 0="49";1 0="4a";1 0="4b";1 0="4c";1 0="4d";1 0="4e";1 0="4f";1 0="4g";1 0="4h";1 0="4i";1 0="4j";1 0="4k";1 0="4l";1 0="4m";1 0="4n";1 0="4o";1 0="4p";1 0="4q";1 0="4r";1 0="4s";1 0="4t";1 0="4u";1 0="4v";1 0="4w";1 0="4x";1 0="4y";1 0="4z";1 0="4A";1 0="4B";1 0="4C";1 0="4D";1 0="4E";1 0="4F";1 0="4G";1 0="4H";1 0="4I";1 0="4J";1 0="4K";1 0="4L";1 0="4M";1 0="4N";1 0="4O";1 0="4P";1 0="4Q";1 0="4R";1 0="4S";1 0="4T";1 0="4U";1 0="4V";1 0="4W";1 0="4X";1 0="4Y";1 0="4Z";1 0="50";1 0="51";1 0="52";1 0="53";1 0="54";1 0="55";1 0="56";1 0="57";1 0="58";1 0="59";1 0="5a";1 0="5b";1 0="5c";1 0="5d";1 0="5e";1 0="5f";1 0="5g";1 0="5h";1 0="5i";1 0="5j";1 0="5k";1 0="5l";1 0="5m";1 0="5n";1 0="5o";1 0="5p";1 0="5q";1 0="5r";1 0="5s";1 0="5t";1 0="5u";1 0="5v";1 0="5w";1 0="5x";1 0="5y";1 0="5z";1 0="5A";1 0="5B";1 0="5C";1 0="5D";1 0="5E";1 0="5F";1 0="5G";1 0="5H";1 0="5I";1 0="5J";1 0="5K";1 0="5L";1 0="5M";1 0="5N";1 0="5O";1 0="5P";1 0="5Q";1 0="5R";1 0="5S";1 0="5T";1 0="5U";1 0="5V";1 0="5W";1 0="5X";1 0="5Y";1 0="5Z";1 0="60";1 0="61";1 0="62";1 0="63";1 0="64";1 0="65";1 0="66";1 0="67";1 0="68";1 0="33";1 0="6a";1 0="6b";1 0="6c";1 0="6d";1 0="6e";1 0="6f";1 0="6g";1 0="6h";1 0="6i";1 0="6j";1 0="6k";1 0="6l";1 0="6m";1 0="6n";1 0="6o";1 0="6p";1 0="6q";1 0="6r";1 0="6s";1 0="6t";1 0="6u";1 0="6v";1 0="6w";1 0="6x";1 0="6y";1 0="6z";1 0="6A";1 0="6B";1 0="6C";1 0="6D";1 0="6E";1 0="6F";1 0="6G";1 0="6H";1 0="6I";1 0="6J";1 0="6K";1 0="6L";1 0="6M";1 0="6N";1 0="6O";1 0="6P";1 0="6Q";1 0="6R";1 0="6S";1 0="6T";1 0="6U";1 0="6V";1 0="6W";1 0="6X";1 0="6Y";1 0="6Z";1 0="70";1 0="71";1 0="72";1 0="73";1 0="74";1 0="75";1 0="76";1 0="77";1 0="78";1 0="79";1 0="7a";1 0="7b";1 0="7c";1 0="7d";1 0="7e";1 0="7f";1 0="7g";1 0="7h";1 0="7i";1 0="7j";1 0="7k";1 0="7l";1 0="7m";1 0="7n";1 0="7o";1 0="7p";1 0="7q";1 0="7r";1 0="7s";1 0="7t";1 0="7u";1 0="7v";1 0="7w";1 0="7x";1 0="7y";1 0="7z";1 0="7A";1 0="7B";1 0="7C";1 0="7D";1 0="7E";1 0="7F";1 0="7G";1 0="7H";1 0="7I";1 0="7J";1 0="7K";1 0="7L";1 0="7M";1 0="7N";1 0="7O";1 0="7P";1 0="7Q";1 0="7R";1 0="7S";1 0="7T";1 0="7U";1 0="7V";1 0="7W";1 0="7X";1 0="7Y";1 0="7Z";1 0="80";1 0="81";1 0="82";1 0="83";1 0="84";1 0="85";1 0="86";1 0="87";1 0="88";1 0="89";1 0="8a";1 0="8b";1 0="8c";1 0="10";1 0="8e";1 0="8f";1 0="8g";1 0="8h";1 0="8i";1 0="8j";1 0="8k";1 0="8l";1 0="8m";1 0="8n";1 0="8o";1 0="8p";1 0="8q";1 0="8r";1 0="8s";1 0="8t";1 0="8u";1 0="8v";1 0="8w";1 0="8x";1 0="8y";1 0="8z";1 0="8A";1 0="8B";1 0="8C";1 0="8D";1 0="8E";1 0="8F";1 0="8G";1 0="8H";1 0="8I";1 0="8J";1 0="8K";1 0="8L";1 0="8M";1 0="8N";1 0="8O";1 0="8P";1 0="8Q";1 0="8R";1 0="8S";1 0="8T";1 0="8U";1 0="8V";1 0="8W";1 0="8X";1 0="8Y";1 0="8Z";1 0="90";1 0="91";1 0="92";1 0="93";1 0="94";1 0="95";1 0="96";1 0="97";1 0="98";1 0="99";1 0="9a";1 0="9b";1 0="9c";1 0="9d";1 0="9e";1 0="9f";1 0="9g";1 0="9h";1 0="9i";1 0="9j";1 0="9k";1 0="9l";1 0="9m";1 0="9n";1 0="9o";1 0="9p";1 0="9q";1 0="9r";1 0="9s";1 0="9t";1 0="9u";1 0="9v";1 0="9w";1 0="9x";1 0="9y";1 0="9z";1 0="9A";1 0="9B";1 0="9C";1 0="9D";1 0="9E";1 0="9F";1 0="9G";1 0="9H";1 0="9I";1 0="9J";1 0="9K";1 0="9L";1 0="9M";1 0="9N";1 0="9O";1 0="9P";1 0="9Q";1 0="9R";1 0="9S";1 0="9T";1 0="9U";1 0="9V";1 0="9W";1 0="9X";1 0="9Y";1 0="9Z";1 0="a0";1 0="a1";1 0="a2";1 0="a3";1 0="a4";1 0="a5";1 0="a6";1 0="a7";1 0="a8";1 0="a9";1 0="aa";1 0="ab";1 0="ac";1 0="ad";1 0="ae";1 0="af";1 0="ag";1 0="ah";1 0="ai";1 0="aj";1 0="ak";1 0="al";1 0="am";1 0="an";1 0="ao";1 0="ap";1 0="aq";1 0="ar";1 0="as";1 0="at";1 0="au";1 0="av";1 0="aw";1 0="ax";1 0="ay";1 0="az";1 0="aA";1 0="aB";1 0="aC";1 0="aD";1 0="aE";1 0="aF";1 0="aG";1 0="aH";1 0="aI";1 0="aJ";1 0="aK";1 0="aL";1 0="aM";1 0="aN";1 0="aO";1 0="aP";1 0="aQ";1 0="aR";1 0="aS";1 0="aT";1 0="aU";1 0="aV";1 0="aW";1 0="aX";1 0="aY";1 0="aZ";1 0="b0";1 0="b1";1 0="b2";1 0="b3";1 0="b4";1 0="b5";1 0="b6";1 0="b7";1 0="b8";1 0="b9";1 0="ba";1 0="bb";1 0="bc";1 0="bd";1 0="be";1 0="bf";1 0="bg";1 0="bh";1 0="bi";1 0="bj";1 0="bk";1 0="bl";1 0="bm";1 0="bn";1 0="bo";1 0="bp";1 0="bq";1 0="br";1 0="bs";1 0="bt";1 0="bu";1 0="bv";1 0="bw";1 0="bx";1 0="by";1 0="bz";1 0="bA";1 0="bB";1 0="bC";1 0="bD";1 0="bE";1 0="bF";1 0="bG";1 0="bH";1 0="bI";1 0="bJ";1 0="bK";1 0="bL";1 0="bM";1 0="bN";1 0="bO";1 0="bP";1 0="bQ";1 0="bR";1 0="bS";1 0="bT";1 0="bU";1 0="bV";1 0="bW";1 0="bX";1 0="bY";1 0="bZ";1 0="c0";1 0="c1";1 0="c2";1 0="c3";1 0="c4";1 0="c5";1 0="c7";',62,752,'aaa|var|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|breagupopf|werjimrcgo|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|kgrufshhbi|klucopuyfg|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|vsxvrorijn|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|prrrrbwosb|eixeiqnpio|klwbiuhskx|yommhlpsuv|lwswqksvjf|gyrwjmamam|qqetupasqh|gwqvowymto|wybagnxuqd|djsqhkplsc|hlqrgvlpxs|qifaiqysrk|fyehbjrvni|pdjgenegvl|kjitkvolqr|ferdukxfks|rpiewigpby|akefenlgif|klbmmuwpyd|jnyltfmttp|lujysqvawj|hhvjmofslr|wdaatluhox|fqhbhwqbmr|ggurrkfxov|wjffwansnv|esjiemwyad|tqgmsangoe|rlpulmorwi|nnxcuhnckd|ctsembjxcf|aangwfpqys|xmngfoerny|jrpbnulpox|dpsqoauwnm|rauugjkijg|ollwsllkqs|kvnikdxeph|cuwllwndam|bkrijtslix|wuwjssnhjt|gmcraaparp|fjhoonafof|eufttbynsp|axfbvrfddk|dkdfxxqbxf|fqwbljbgmh|jqwamoqnrh|mefhlhkigy|yooqjnroiu|iaooxoaipe|lusglgaysi|oufkboxjnf|bcvtqsyrbw|wrijmpchex|usbedqodtq|uvqdqdkyse|dfouomesrt|khvcwpbwgg|wkldupuafq|jcbdxmsubk|nrgojtequh|vkfvrxtklp|gkpjfvsuwd|ktyflbwbmh|rfecruligy|ufhrnyakqf|hqyqhupmol|xlokvsfkah|soqbgydpxm|xtonuesqvg|hlwyjdmkfd|vwsifvbbff|hqruytxtlv|jfykspsvrm|tbauhtygkk|fquhewgbdb|oyybyrelad|qtccfyrcgs|cbrwxeowqq|wfoqdpybil|ikanvyvjmm|tqeqmaufol|wvujwtcnah|olapskhbpj|stfovrpsfe|blvrbrupjk|ofacjnjqbo|tclgntfagf|xbseencenh|kthsdhprsq|tfpajwfgjs|wbhklegkwy|nrqsshpuwl|jtkpbwyruo|xbvjyeptje|cbhhlmgnhc|ueuhgmnbpe|tjqrxnykrt|hdnxaktmib|ulgxqqxuhq|djlwgjoncp|bewccrvvwk|gwugxhfash|oonbpqpouj|hdilbbrgeo|bsqnetaheb|gaoyyttudo|aapupxyxoa|fpamqvwvgv|rvdmbvbvde|mtkxdyajpy|xoajfcbxmb|qflgiwqgfb|qcjeevkpuv|iontkfrobc|ncpwklekjw|pqhytepvxr|iyxkvcncud|tnqgxplmdb|agwbspfopi|wckdutjygo|priunngtip|qpiprdyjnw|ksjgdjlgdw|fefxhsdnut|ahfubmxgps|vvnekomybk|kdvqllyqpu|hbfsnuikpl|ahkebjwssv|qyuitbvfis|uqbaxujbiq|vpxrirabal|ntdequjjwj|wqstmjuygy|iocgjwalgg|ojvevginrc|iafnlktqal|mjpynjnydj|fccequfmhy|onymdbdxuf|bxpwdrxnis|raivofactb|uqampwtwob|haicwqbpqf|rwqpkdcbsj|hnpjspdpjj|maedfwfiow|smqigfjfxi|pqgkcjydcm|tujevpuuli|sujvoiwohs|hqfwgohvwq|auwjikxtha|rrkccxyxky|dvvgdwkenb|ldnsbuiaup|ineipkhohb|rddfnjadgt|makluthjim|ymgvbdimnx|djqyumugkn|wplsmntryf|kjukmfwwji|fnxbopikau|pfboshiqbg|yluoljqghf|taptwfnpnw|gnqnsuttjy|jlfscwefty|heucdpmecn|ihvtsaybqn|loufssrhmd|xxpvtbnrxl|mslcvkyptu|scfksirfus|coasnpqbal|frpifjsmhm|oyrsxupppa|gtmxstmxgw|lccbddnnxf|nsvtputckc|ipqfitwaug|oesowuyhec|mpvjqrovvj|xxnrgytkal|mgjxiypeqt|pqcdouxabn|dtneacihbl|cjkkvfskdf|gqqkfmujtg|idasgwdylf|mtmbwnwhrf|febkulwcwd|udgappxnfc|oeounuhwho|sjpqtqrlpv|pagnwrxrps|qqrwiuthuk|ijmjsqqctu|sqbctxhqne|mxvdkrcswp|wcqorskhol|fwgegcvyec|iorwpkftgx|rjnrhluhci|twyktwpkkk|jcvnnqxela|npmnauyenx|fmjifmxmga|nagwfhcnpq|bsicplsatb|atphmlaoti|owoagpdhvv|okeajpbnml|ukugrdjpet|rlgpjsyaje|rcdoecobqx|wikoprekab|hhhjlawjis|eqfgphcyhk|miablyqdsg|uqgjqnclce|ynjeaqhhvj|pcchimuvyc|karmvhawrd|upavyhppju|hxbpptxgir|kcrneyprmt|dneeaxevhr|ptxonkmnvo|tofaghvfya|asxkecbpgq|keofkhhidm|ygfcouswlh|rkpborjnhw|bjvmvvayqv|boqvpyuqyx|jjitbhfabt|rlmqtiyefm|grbkccnwjb|cxilkyoaqe|nytoiomruk|wkhaxwvsig|mkmqouhlux|kxqybgmbvd|gyohmkaghk|nosthntnpc|eecfofhkey|otaftyplld|qwdbbvvpae|dchthgxlkt|kedssfykwf|iefptayfoj|xvflxsflyy|dkfunrmbml|hklmsgmebu|fcirkivtaw|kpkeherygc|tegoqadwhs|ouajtcnaex|fpuxxupevj|suwajflhib|mxpjkxtpiv|wvixbjmqxx|kxskivawug|ogurbgvlxc|mrpvryjxho|qtregjalbx|dpttetgwab|ivrepttkad|xwtekkgmmg|goncgoetoo|xtmebvdmnt|avwxmhxlmt|mblpkonkru|octdffpxvi|cphaimnkem|pgqkixhkrm|neweqlvykv|rwpaxtvvcd|meoeqvikvf|sesidaswum|lnvflqrsut|acxdeigusf|axespcbupb|jnfmaarrwu|vtxrrjbvbi|ahvtdtqgeb|tulgfqygrd|mrjaalwnry|ygrubyjsbe|hppeeiysix|anejrvremq|uimvbkbguk|yvmenqbdyt|pfqofbbexs|nvafvegcmx|ebrcndduai|gyirklbcgq|gurtqinfyx|naxqjcbpaw|drwquymxmo|gkpewoxsxd|unrtnfsamm|lbaaytsmoc|xtbseujdgw|oigdahqrfg|vmkvdsnxsa|udwyblgvvg|wceowsfods|fghfcpkisi|frljvpjaug|akvggmvlir|rerlxfvsjg|vbtderkpoi|xajswoxdfk|kehfcqgiwe|juyadrkyla|olulyxbatd|elotjjgfqn|vxvpaqlxed|qtauqxvyei|fjcnklrisf|snmesqlwhg|qyoukmdqmj|qcadvxkmee|owwpkwwkyh|botpindxwv|kkwjxbmfsc|cwynvaodvp|iftehefeeq|ofgdiwxphw|iwobhhslvy|aqjldssjbw|mmphapfpfw|sugbfunmgr|aikbnbspwv|frhxurmxld|wivoakyeve|esmlvkoeom|qhivtruvyr|swqadbqalh|iryygfbedr|aaoebkeoyr|hkxaucfnnq|gkcuwtucbc|flodjmegvp|lfbvpaolbu|tarrpxddqa|frkhgcfuqv|vjoeaoyeno|krqssjimfr|tsyflxeijs|tylqhkwaas|jtlmqxdnjt|ubqfchijhx|bjeydheeij|tuanpfdwwk|tyqfdrjpdj|hbtcpwygkq|dfcxtkuqaa|xsqfsjafdg|rieypwriub|gbsckpuqut|aacrtfuwpl|kmdejtxjxa|egjlvhukcm|ulnkdmpycn|jqbtoxxcgo|cccmxkqdow|dsnjuekdbs|fbiagfpxfg|lrqhhmonth|oemdeiarih|bfjufckwkw|hofetwrjtg|wjhnenwnxc|mpaexvbqxr|lwpvpafxej|kcmaahkykh|rmpbqaaffn|qljnmfcloc|ippvtsxbod|bdvueubwmi|iedcgpjgpr|dfvhvnwoyy|owrupuccbw|htswogsaag|cxjqvygxlq|pojmgslclk|slrjasubwl|ytxwcophfu|gaappkktuu|xcjheivnkb|yclmegwinr|gmgtibralg|hbbyhdgvgd|iqqxhgljlq|ioafsqlube|hurcahkfvr|sxlnfqfinr|pmmstdviqb|pbdhumkbqm|plbnummold|wsekvwumls|xkrowadmri|wqtpyxskkc|ksqvlhsojv|tshxulebut|ifwwvaksgp|keqjwcoaaf|txxxhoagmd|akrltggutp|bjqbkhubnr|qoqficdvmb|mimaublaih|obeqslvrpo|cxhhqhiyls|grvohirlnp|kehnofmsyg|fwclgrfefr|ytbfwqvtti|jknckpjvhn|okqwbysbow|oyypuobjin|jqkctlxmrw|enpnhvbehu|gkpsfnalwd|bpxtscthrw|sasnrnpwng|lgprxcajmn|ejhmxbuffq|nvuivrutbq|yitiodnnqt|mvkrmomisv|cxehbowcix|gxbkwvufbd|anvnfbhjbg|jbqttgbrbo|jljyujcucf|cjjenppbhq|cddbacgtur|bujctpjkyu|uphxoakjts|rtoqmbvdjy|bkvlprcyoo|jhwduvkgfq|rolmglkbgd|ueuebvnjde|hroisscxdh|vlsomwjfki|dakowybtvo|mpihrdtcvj|noybppfrnu|fqnmvxfoum|axgcleopvd|esuhnaillm|bsohidnmrg|qafwplsulf|ebhxeqarwh|gpcykuiapl|bhlqfuknbi|jelewrejnv|qfmbsuygki|kjkiavpjga|ymnryrmhyd|lqmobpncox|vpwvhjqhoy|lardapowjh|bocsopwnxs|htgstsuqfb|jqpknssjdl|huuosujkbv|pmcqlphghv|xfmfcuefnx|vdyvelvcng|suftgiquvn|yweryjgrwc|wjopiwjtrk|mscpeaqfvq|mlxmvhvkeo|fsghgqkvef|aidtwgbyyu|sjsoiggwya|prldgrxjhi|cqcooipxus|jylrqlbyie|yhatfowfuy|fsfqvpgsqg|phdabnjdgf|cgpddfdsvm|lrgdversqc|xdqfbdpcmx|mybvirnicf|fnmqudtjud|nvrqlrhgfx|dlxuhmwhqw|ivnvnnwwrr|qhexnienoa|xruvubmbll|tbcvvmyayr|omvvhspkja|gvtoyhells|wepknrkirs|tiuowenuix|yddslqnwxu|nvknwgnnar|ikxidbswff|aegcdpvwsm|bcpjcnjggt|fhietucpbd|buyhoamsds|eccsjgaatf|mxlgwfuaru|gfiewmswxm|awiiwejiqe|mersknkrcx|dtdpmdebes|ihwfyhoncn|gaatuovobu|xdbgpaopxu|ahoybbfivt|itpdyrqtny|lfuytlpxef|wwlllaetiq|lvuyexitpu|fuxovadtog|qtsqokhqul|mowlfmhqqr|eflxxpyoch|sdmoqvgvdk|uvyjknajsi|wqhwakjbxq|bqxgwdcffj|wvwshhjnho|legukwvsob|acbjtgubvy|pggmujexmn|uloalbeyko|kulyobpixh|hanmbcjfam|xwottiyehy|dkppvgieid|eqawetuddx|iuwyflqbve|kbuxirxoga|xblhlkugon|utqggdcesd|hgakyyhysh|nuneaaasko'.split('|'),0,{}))
+});
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-packer-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-packer-3.html
new file mode 100644
index 00000000000..cde5dc78e50
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-packer-3.html
@@ -0,0 +1,33 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Unpack', onlyNum = 4;
+function thisTest() {
+
+startTest("real-packer");
+
+test("Unpack", 1, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="O";0 1="5";0 1="2";0 1="4";0 1="J";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="u";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="t";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="P";',52,52,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|wrijmpchex|lccbddnnxf|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|vmkvdsnxsa|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|hgakyyhysh|iereeyrdnh'.split('|'),0,{}))
+});
+
+test("Unpack", 2, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('1 0="1C";1 0="5";1 0="2";1 0="4";1 0="1v";1 0="6";1 0="7";1 0="8";1 0="3";1 0="a";1 0="b";1 0="c";1 0="10";1 0="d";1 0="f";1 0="g";1 0="h";1 0="i";1 0="j";1 0="k";1 0="9";1 0="m";1 0="n";1 0="o";1 0="p";1 0="q";1 0="r";1 0="s";1 0="Z";1 0="e";1 0="v";1 0="w";1 0="x";1 0="y";1 0="z";1 0="A";1 0="B";1 0="C";1 0="D";1 0="E";1 0="F";1 0="G";1 0="H";1 0="I";1 0="l";1 0="K";1 0="L";1 0="M";1 0="N";1 0="O";1 0="P";1 0="Q";1 0="R";1 0="S";1 0="T";1 0="U";1 0="V";1 0="W";1 0="X";1 0="Y";1 0="u";1 0="t";1 0="11";1 0="12";1 0="13";1 0="14";1 0="15";1 0="16";1 0="17";1 0="18";1 0="19";1 0="1a";1 0="1b";1 0="1c";1 0="1d";1 0="1e";1 0="1f";1 0="1g";1 0="1h";1 0="1i";1 0="1j";1 0="1k";1 0="1l";1 0="1m";1 0="1n";1 0="1o";1 0="1p";1 0="1q";1 0="1r";1 0="1s";1 0="1t";1 0="1u";1 0="J";1 0="1w";1 0="1x";1 0="1y";1 0="1z";1 0="1A";1 0="1B";1 0="1D";',62,102,'aaa|var|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|bcvtqsyrbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|wrijmpchex|lccbddnnxf|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|vmkvdsnxsa|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|hgakyyhysh|rsbgawetse'.split('|'),0,{}))
+});
+
+test("Unpack", 4, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="3e";0 1="5";0 1="2";0 1="4";0 1="33";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="22";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="21";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="O";0 1="P";0 1="Q";0 1="R";0 1="S";0 1="T";0 1="U";0 1="V";0 1="W";0 1="X";0 1="Y";0 1="10";0 1="t";0 1="11";0 1="12";0 1="13";0 1="14";0 1="15";0 1="16";0 1="17";0 1="18";0 1="19";0 1="1a";0 1="1b";0 1="1c";0 1="1d";0 1="1e";0 1="1f";0 1="1g";0 1="1h";0 1="1i";0 1="1j";0 1="1k";0 1="1l";0 1="1m";0 1="1n";0 1="1o";0 1="1p";0 1="1q";0 1="1r";0 1="1s";0 1="1t";0 1="1u";0 1="J";0 1="1w";0 1="1x";0 1="1y";0 1="1z";0 1="1A";0 1="1B";0 1="1C";0 1="1D";0 1="1E";0 1="1F";0 1="1G";0 1="1H";0 1="1I";0 1="1J";0 1="1K";0 1="1L";0 1="1M";0 1="1N";0 1="1O";0 1="1P";0 1="1Q";0 1="1R";0 1="1S";0 1="1T";0 1="1U";0 1="1V";0 1="1W";0 1="1X";0 1="1Y";0 1="1Z";0 1="20";0 1="Z";0 1="u";0 1="23";0 1="24";0 1="25";0 1="26";0 1="27";0 1="28";0 1="29";0 1="2a";0 1="2b";0 1="2c";0 1="2d";0 1="2e";0 1="2f";0 1="2g";0 1="2h";0 1="2i";0 1="2j";0 1="2k";0 1="2l";0 1="2m";0 1="2n";0 1="2o";0 1="2p";0 1="2q";0 1="2r";0 1="2s";0 1="2t";0 1="2u";0 1="2v";0 1="2w";0 1="2x";0 1="2y";0 1="2z";0 1="2A";0 1="2B";0 1="2C";0 1="2D";0 1="2E";0 1="2F";0 1="2G";0 1="2H";0 1="2I";0 1="2J";0 1="2K";0 1="2L";0 1="2M";0 1="2N";0 1="2O";0 1="2P";0 1="2Q";0 1="2R";0 1="2S";0 1="2T";0 1="2U";0 1="2V";0 1="2W";0 1="2X";0 1="2Y";0 1="2Z";0 1="30";0 1="31";0 1="32";0 1="1v";0 1="34";0 1="35";0 1="36";0 1="37";0 1="38";0 1="39";0 1="3a";0 1="3b";0 1="3c";0 1="3d";0 1="3f";',62,202,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|klucopuyfg|bcvtqsyrbw|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|wrijmpchex|lccbddnnxf|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|vmkvdsnxsa|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|hgakyyhysh|prrrrbwosb'.split('|'),0,{}))
+});
+
+test("Unpack", 8, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="5E";0 1="5";0 1="2";0 1="4";0 1="45";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="33";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="22";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="O";0 1="P";0 1="Q";0 1="R";0 1="S";0 1="T";0 1="U";0 1="V";0 1="W";0 1="X";0 1="Y";0 1="21";0 1="t";0 1="11";0 1="12";0 1="13";0 1="14";0 1="15";0 1="16";0 1="17";0 1="18";0 1="19";0 1="1a";0 1="1b";0 1="1c";0 1="1d";0 1="1e";0 1="1f";0 1="1g";0 1="1h";0 1="1i";0 1="1j";0 1="1k";0 1="1l";0 1="1m";0 1="1n";0 1="1o";0 1="1p";0 1="1q";0 1="1r";0 1="1s";0 1="1t";0 1="1u";0 1="J";0 1="1w";0 1="1x";0 1="1y";0 1="1z";0 1="1A";0 1="1B";0 1="1C";0 1="1D";0 1="1E";0 1="1F";0 1="1G";0 1="1H";0 1="1I";0 1="1J";0 1="1K";0 1="1L";0 1="1M";0 1="1N";0 1="1O";0 1="1P";0 1="1Q";0 1="1R";0 1="1S";0 1="1T";0 1="1U";0 1="1V";0 1="1W";0 1="1X";0 1="1Y";0 1="1Z";0 1="20";0 1="10";0 1="u";0 1="23";0 1="24";0 1="25";0 1="26";0 1="27";0 1="28";0 1="29";0 1="2a";0 1="2b";0 1="2c";0 1="2d";0 1="2e";0 1="2f";0 1="2g";0 1="2h";0 1="2i";0 1="2j";0 1="2k";0 1="2l";0 1="2m";0 1="2n";0 1="2o";0 1="2p";0 1="2q";0 1="2r";0 1="2s";0 1="2t";0 1="2u";0 1="2v";0 1="2w";0 1="2x";0 1="2y";0 1="2z";0 1="2A";0 1="2B";0 1="2C";0 1="2D";0 1="2E";0 1="2F";0 1="2G";0 1="2H";0 1="2I";0 1="2J";0 1="2K";0 1="2L";0 1="2M";0 1="2N";0 1="2O";0 1="2P";0 1="2Q";0 1="2R";0 1="2S";0 1="2T";0 1="2U";0 1="2V";0 1="2W";0 1="2X";0 1="2Y";0 1="2Z";0 1="30";0 1="31";0 1="32";0 1="1v";0 1="34";0 1="35";0 1="36";0 1="37";0 1="38";0 1="39";0 1="3a";0 1="3b";0 1="3c";0 1="3d";0 1="3e";0 1="3f";0 1="3g";0 1="3h";0 1="3i";0 1="3j";0 1="3k";0 1="3l";0 1="3m";0 1="3n";0 1="3o";0 1="3p";0 1="3q";0 1="3r";0 1="3s";0 1="3t";0 1="3u";0 1="3v";0 1="3w";0 1="3x";0 1="3y";0 1="3z";0 1="3A";0 1="3B";0 1="3C";0 1="3D";0 1="3E";0 1="3F";0 1="3G";0 1="3H";0 1="3I";0 1="3J";0 1="3K";0 1="3L";0 1="3M";0 1="3N";0 1="3O";0 1="3P";0 1="3Q";0 1="3R";0 1="3S";0 1="3T";0 1="3U";0 1="3V";0 1="3W";0 1="3X";0 1="3Y";0 1="3Z";0 1="40";0 1="41";0 1="42";0 1="43";0 1="44";0 1="Z";0 1="46";0 1="47";0 1="48";0 1="49";0 1="4a";0 1="4b";0 1="4c";0 1="4d";0 1="4e";0 1="4f";0 1="4g";0 1="4h";0 1="4i";0 1="4j";0 1="4k";0 1="4l";0 1="4m";0 1="4n";0 1="4o";0 1="4p";0 1="4q";0 1="4r";0 1="4s";0 1="4t";0 1="4u";0 1="4v";0 1="4w";0 1="4x";0 1="4y";0 1="4z";0 1="4A";0 1="4B";0 1="4C";0 1="4D";0 1="4E";0 1="4F";0 1="4G";0 1="4H";0 1="4I";0 1="4J";0 1="4K";0 1="4L";0 1="4M";0 1="4N";0 1="4O";0 1="4P";0 1="4Q";0 1="4R";0 1="4S";0 1="4T";0 1="4U";0 1="4V";0 1="4W";0 1="4X";0 1="4Y";0 1="4Z";0 1="50";0 1="51";0 1="52";0 1="53";0 1="54";0 1="55";0 1="56";0 1="57";0 1="58";0 1="59";0 1="5a";0 1="5b";0 1="5c";0 1="5d";0 1="5e";0 1="5f";0 1="5g";0 1="5h";0 1="5i";0 1="5j";0 1="5k";0 1="5l";0 1="5m";0 1="5n";0 1="5o";0 1="5p";0 1="5q";0 1="5r";0 1="5s";0 1="5t";0 1="5u";0 1="5v";0 1="5w";0 1="5x";0 1="5y";0 1="5z";0 1="5A";0 1="5B";0 1="5C";0 1="5D";0 1="5F";',62,352,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|kgrufshhbi|klucopuyfg|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|bcvtqsyrbw|wrijmpchex|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|lccbddnnxf|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|prrrrbwosb|eixeiqnpio|klwbiuhskx|yommhlpsuv|lwswqksvjf|gyrwjmamam|qqetupasqh|gwqvowymto|wybagnxuqd|djsqhkplsc|hlqrgvlpxs|qifaiqysrk|fyehbjrvni|pdjgenegvl|kjitkvolqr|ferdukxfks|rpiewigpby|akefenlgif|klbmmuwpyd|jnyltfmttp|lujysqvawj|hhvjmofslr|wdaatluhox|fqhbhwqbmr|ggurrkfxov|wjffwansnv|esjiemwyad|tqgmsangoe|rlpulmorwi|nnxcuhnckd|ctsembjxcf|aangwfpqys|xmngfoerny|jrpbnulpox|dpsqoauwnm|rauugjkijg|ollwsllkqs|kvnikdxeph|cuwllwndam|bkrijtslix|wuwjssnhjt|gmcraaparp|fjhoonafof|eufttbynsp|axfbvrfddk|dkdfxxqbxf|fqwbljbgmh|jqwamoqnrh|mefhlhkigy|yooqjnroiu|iaooxoaipe|lusglgaysi|oufkboxjnf|vmkvdsnxsa|breagupopf|usbedqodtq|uvqdqdkyse|dfouomesrt|khvcwpbwgg|wkldupuafq|jcbdxmsubk|nrgojtequh|vkfvrxtklp|gkpjfvsuwd|ktyflbwbmh|rfecruligy|ufhrnyakqf|hqyqhupmol|xlokvsfkah|soqbgydpxm|xtonuesqvg|hlwyjdmkfd|vwsifvbbff|hqruytxtlv|jfykspsvrm|tbauhtygkk|fquhewgbdb|oyybyrelad|qtccfyrcgs|cbrwxeowqq|wfoqdpybil|ikanvyvjmm|tqeqmaufol|wvujwtcnah|olapskhbpj|stfovrpsfe|blvrbrupjk|ofacjnjqbo|tclgntfagf|xbseencenh|kthsdhprsq|tfpajwfgjs|wbhklegkwy|nrqsshpuwl|jtkpbwyruo|xbvjyeptje|cbhhlmgnhc|ueuhgmnbpe|tjqrxnykrt|hdnxaktmib|ulgxqqxuhq|djlwgjoncp|bewccrvvwk|gwugxhfash|oonbpqpouj|hdilbbrgeo|bsqnetaheb|gaoyyttudo|aapupxyxoa|fpamqvwvgv|rvdmbvbvde|mtkxdyajpy|xoajfcbxmb|qflgiwqgfb|qcjeevkpuv|iontkfrobc|ncpwklekjw|pqhytepvxr|iyxkvcncud|tnqgxplmdb|agwbspfopi|wckdutjygo|priunngtip|qpiprdyjnw|ksjgdjlgdw|fefxhsdnut|ahfubmxgps|vvnekomybk|kdvqllyqpu|hbfsnuikpl|ahkebjwssv|qyuitbvfis|uqbaxujbiq|vpxrirabal|ntdequjjwj|wqstmjuygy|iocgjwalgg|ojvevginrc|iafnlktqal|mjpynjnydj|fccequfmhy|onymdbdxuf|bxpwdrxnis|raivofactb|uqampwtwob|haicwqbpqf|rwqpkdcbsj|hnpjspdpjj|maedfwfiow|smqigfjfxi|hgakyyhysh|pqgkcjydcm'.split('|'),0,{}))
+});
+
+test("Unpack", 16, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('1 0="c6";1 0="5";1 0="2";1 0="4";1 0="8d";1 0="6";1 0="7";1 0="8";1 0="3";1 0="a";1 0="b";1 0="c";1 0="69";1 0="d";1 0="f";1 0="g";1 0="h";1 0="i";1 0="j";1 0="k";1 0="9";1 0="m";1 0="n";1 0="o";1 0="p";1 0="q";1 0="r";1 0="s";1 0="46";1 0="e";1 0="v";1 0="w";1 0="x";1 0="y";1 0="z";1 0="A";1 0="B";1 0="C";1 0="D";1 0="E";1 0="F";1 0="G";1 0="H";1 0="I";1 0="l";1 0="K";1 0="L";1 0="M";1 0="N";1 0="O";1 0="P";1 0="Q";1 0="R";1 0="S";1 0="T";1 0="U";1 0="V";1 0="W";1 0="X";1 0="Y";1 0="45";1 0="t";1 0="11";1 0="12";1 0="13";1 0="14";1 0="15";1 0="16";1 0="17";1 0="18";1 0="19";1 0="1a";1 0="1b";1 0="1c";1 0="1d";1 0="1e";1 0="1f";1 0="1g";1 0="1h";1 0="1i";1 0="1j";1 0="1k";1 0="1l";1 0="1m";1 0="1n";1 0="1o";1 0="1p";1 0="1q";1 0="1r";1 0="1s";1 0="1t";1 0="1u";1 0="J";1 0="1w";1 0="1x";1 0="1y";1 0="1z";1 0="1A";1 0="1B";1 0="1C";1 0="1D";1 0="1E";1 0="1F";1 0="1G";1 0="1H";1 0="1I";1 0="1J";1 0="1K";1 0="1L";1 0="1M";1 0="1N";1 0="1O";1 0="1P";1 0="1Q";1 0="1R";1 0="1S";1 0="1T";1 0="1U";1 0="1V";1 0="1W";1 0="1X";1 0="1Y";1 0="1Z";1 0="20";1 0="22";1 0="u";1 0="23";1 0="24";1 0="25";1 0="26";1 0="27";1 0="28";1 0="29";1 0="2a";1 0="2b";1 0="2c";1 0="2d";1 0="2e";1 0="2f";1 0="2g";1 0="2h";1 0="2i";1 0="2j";1 0="2k";1 0="2l";1 0="2m";1 0="2n";1 0="2o";1 0="2p";1 0="2q";1 0="2r";1 0="2s";1 0="2t";1 0="2u";1 0="2v";1 0="2w";1 0="2x";1 0="2y";1 0="2z";1 0="2A";1 0="2B";1 0="2C";1 0="2D";1 0="2E";1 0="2F";1 0="2G";1 0="2H";1 0="2I";1 0="2J";1 0="2K";1 0="2L";1 0="2M";1 0="2N";1 0="2O";1 0="2P";1 0="2Q";1 0="2R";1 0="2S";1 0="2T";1 0="2U";1 0="2V";1 0="2W";1 0="2X";1 0="2Y";1 0="2Z";1 0="30";1 0="31";1 0="32";1 0="1v";1 0="34";1 0="35";1 0="36";1 0="37";1 0="38";1 0="39";1 0="3a";1 0="3b";1 0="3c";1 0="3d";1 0="3e";1 0="3f";1 0="3g";1 0="3h";1 0="3i";1 0="3j";1 0="3k";1 0="3l";1 0="3m";1 0="3n";1 0="3o";1 0="3p";1 0="3q";1 0="3r";1 0="3s";1 0="3t";1 0="3u";1 0="3v";1 0="3w";1 0="3x";1 0="3y";1 0="3z";1 0="3A";1 0="3B";1 0="3C";1 0="3D";1 0="3E";1 0="3F";1 0="3G";1 0="3H";1 0="3I";1 0="3J";1 0="3K";1 0="3L";1 0="3M";1 0="3N";1 0="3O";1 0="3P";1 0="3Q";1 0="3R";1 0="3S";1 0="3T";1 0="3U";1 0="3V";1 0="3W";1 0="3X";1 0="3Y";1 0="3Z";1 0="40";1 0="41";1 0="42";1 0="43";1 0="44";1 0="21";1 0="Z";1 0="47";1 0="48";1 0="49";1 0="4a";1 0="4b";1 0="4c";1 0="4d";1 0="4e";1 0="4f";1 0="4g";1 0="4h";1 0="4i";1 0="4j";1 0="4k";1 0="4l";1 0="4m";1 0="4n";1 0="4o";1 0="4p";1 0="4q";1 0="4r";1 0="4s";1 0="4t";1 0="4u";1 0="4v";1 0="4w";1 0="4x";1 0="4y";1 0="4z";1 0="4A";1 0="4B";1 0="4C";1 0="4D";1 0="4E";1 0="4F";1 0="4G";1 0="4H";1 0="4I";1 0="4J";1 0="4K";1 0="4L";1 0="4M";1 0="4N";1 0="4O";1 0="4P";1 0="4Q";1 0="4R";1 0="4S";1 0="4T";1 0="4U";1 0="4V";1 0="4W";1 0="4X";1 0="4Y";1 0="4Z";1 0="50";1 0="51";1 0="52";1 0="53";1 0="54";1 0="55";1 0="56";1 0="57";1 0="58";1 0="59";1 0="5a";1 0="5b";1 0="5c";1 0="5d";1 0="5e";1 0="5f";1 0="5g";1 0="5h";1 0="5i";1 0="5j";1 0="5k";1 0="5l";1 0="5m";1 0="5n";1 0="5o";1 0="5p";1 0="5q";1 0="5r";1 0="5s";1 0="5t";1 0="5u";1 0="5v";1 0="5w";1 0="5x";1 0="5y";1 0="5z";1 0="5A";1 0="5B";1 0="5C";1 0="5D";1 0="5E";1 0="5F";1 0="5G";1 0="5H";1 0="5I";1 0="5J";1 0="5K";1 0="5L";1 0="5M";1 0="5N";1 0="5O";1 0="5P";1 0="5Q";1 0="5R";1 0="5S";1 0="5T";1 0="5U";1 0="5V";1 0="5W";1 0="5X";1 0="5Y";1 0="5Z";1 0="60";1 0="61";1 0="62";1 0="63";1 0="64";1 0="65";1 0="66";1 0="67";1 0="68";1 0="33";1 0="6a";1 0="6b";1 0="6c";1 0="6d";1 0="6e";1 0="6f";1 0="6g";1 0="6h";1 0="6i";1 0="6j";1 0="6k";1 0="6l";1 0="6m";1 0="6n";1 0="6o";1 0="6p";1 0="6q";1 0="6r";1 0="6s";1 0="6t";1 0="6u";1 0="6v";1 0="6w";1 0="6x";1 0="6y";1 0="6z";1 0="6A";1 0="6B";1 0="6C";1 0="6D";1 0="6E";1 0="6F";1 0="6G";1 0="6H";1 0="6I";1 0="6J";1 0="6K";1 0="6L";1 0="6M";1 0="6N";1 0="6O";1 0="6P";1 0="6Q";1 0="6R";1 0="6S";1 0="6T";1 0="6U";1 0="6V";1 0="6W";1 0="6X";1 0="6Y";1 0="6Z";1 0="70";1 0="71";1 0="72";1 0="73";1 0="74";1 0="75";1 0="76";1 0="77";1 0="78";1 0="79";1 0="7a";1 0="7b";1 0="7c";1 0="7d";1 0="7e";1 0="7f";1 0="7g";1 0="7h";1 0="7i";1 0="7j";1 0="7k";1 0="7l";1 0="7m";1 0="7n";1 0="7o";1 0="7p";1 0="7q";1 0="7r";1 0="7s";1 0="7t";1 0="7u";1 0="7v";1 0="7w";1 0="7x";1 0="7y";1 0="7z";1 0="7A";1 0="7B";1 0="7C";1 0="7D";1 0="7E";1 0="7F";1 0="7G";1 0="7H";1 0="7I";1 0="7J";1 0="7K";1 0="7L";1 0="7M";1 0="7N";1 0="7O";1 0="7P";1 0="7Q";1 0="7R";1 0="7S";1 0="7T";1 0="7U";1 0="7V";1 0="7W";1 0="7X";1 0="7Y";1 0="7Z";1 0="80";1 0="81";1 0="82";1 0="83";1 0="84";1 0="85";1 0="86";1 0="87";1 0="88";1 0="89";1 0="8a";1 0="8b";1 0="8c";1 0="10";1 0="8e";1 0="8f";1 0="8g";1 0="8h";1 0="8i";1 0="8j";1 0="8k";1 0="8l";1 0="8m";1 0="8n";1 0="8o";1 0="8p";1 0="8q";1 0="8r";1 0="8s";1 0="8t";1 0="8u";1 0="8v";1 0="8w";1 0="8x";1 0="8y";1 0="8z";1 0="8A";1 0="8B";1 0="8C";1 0="8D";1 0="8E";1 0="8F";1 0="8G";1 0="8H";1 0="8I";1 0="8J";1 0="8K";1 0="8L";1 0="8M";1 0="8N";1 0="8O";1 0="8P";1 0="8Q";1 0="8R";1 0="8S";1 0="8T";1 0="8U";1 0="8V";1 0="8W";1 0="8X";1 0="8Y";1 0="8Z";1 0="90";1 0="91";1 0="92";1 0="93";1 0="94";1 0="95";1 0="96";1 0="97";1 0="98";1 0="99";1 0="9a";1 0="9b";1 0="9c";1 0="9d";1 0="9e";1 0="9f";1 0="9g";1 0="9h";1 0="9i";1 0="9j";1 0="9k";1 0="9l";1 0="9m";1 0="9n";1 0="9o";1 0="9p";1 0="9q";1 0="9r";1 0="9s";1 0="9t";1 0="9u";1 0="9v";1 0="9w";1 0="9x";1 0="9y";1 0="9z";1 0="9A";1 0="9B";1 0="9C";1 0="9D";1 0="9E";1 0="9F";1 0="9G";1 0="9H";1 0="9I";1 0="9J";1 0="9K";1 0="9L";1 0="9M";1 0="9N";1 0="9O";1 0="9P";1 0="9Q";1 0="9R";1 0="9S";1 0="9T";1 0="9U";1 0="9V";1 0="9W";1 0="9X";1 0="9Y";1 0="9Z";1 0="a0";1 0="a1";1 0="a2";1 0="a3";1 0="a4";1 0="a5";1 0="a6";1 0="a7";1 0="a8";1 0="a9";1 0="aa";1 0="ab";1 0="ac";1 0="ad";1 0="ae";1 0="af";1 0="ag";1 0="ah";1 0="ai";1 0="aj";1 0="ak";1 0="al";1 0="am";1 0="an";1 0="ao";1 0="ap";1 0="aq";1 0="ar";1 0="as";1 0="at";1 0="au";1 0="av";1 0="aw";1 0="ax";1 0="ay";1 0="az";1 0="aA";1 0="aB";1 0="aC";1 0="aD";1 0="aE";1 0="aF";1 0="aG";1 0="aH";1 0="aI";1 0="aJ";1 0="aK";1 0="aL";1 0="aM";1 0="aN";1 0="aO";1 0="aP";1 0="aQ";1 0="aR";1 0="aS";1 0="aT";1 0="aU";1 0="aV";1 0="aW";1 0="aX";1 0="aY";1 0="aZ";1 0="b0";1 0="b1";1 0="b2";1 0="b3";1 0="b4";1 0="b5";1 0="b6";1 0="b7";1 0="b8";1 0="b9";1 0="ba";1 0="bb";1 0="bc";1 0="bd";1 0="be";1 0="bf";1 0="bg";1 0="bh";1 0="bi";1 0="bj";1 0="bk";1 0="bl";1 0="bm";1 0="bn";1 0="bo";1 0="bp";1 0="bq";1 0="br";1 0="bs";1 0="bt";1 0="bu";1 0="bv";1 0="bw";1 0="bx";1 0="by";1 0="bz";1 0="bA";1 0="bB";1 0="bC";1 0="bD";1 0="bE";1 0="bF";1 0="bG";1 0="bH";1 0="bI";1 0="bJ";1 0="bK";1 0="bL";1 0="bM";1 0="bN";1 0="bO";1 0="bP";1 0="bQ";1 0="bR";1 0="bS";1 0="bT";1 0="bU";1 0="bV";1 0="bW";1 0="bX";1 0="bY";1 0="bZ";1 0="c0";1 0="c1";1 0="c2";1 0="c3";1 0="c4";1 0="c5";1 0="c7";',62,752,'aaa|var|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|breagupopf|werjimrcgo|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|kgrufshhbi|klucopuyfg|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|vsxvrorijn|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|prrrrbwosb|eixeiqnpio|klwbiuhskx|yommhlpsuv|lwswqksvjf|gyrwjmamam|qqetupasqh|gwqvowymto|wybagnxuqd|djsqhkplsc|hlqrgvlpxs|qifaiqysrk|fyehbjrvni|pdjgenegvl|kjitkvolqr|ferdukxfks|rpiewigpby|akefenlgif|klbmmuwpyd|jnyltfmttp|lujysqvawj|hhvjmofslr|wdaatluhox|fqhbhwqbmr|ggurrkfxov|wjffwansnv|esjiemwyad|tqgmsangoe|rlpulmorwi|nnxcuhnckd|ctsembjxcf|aangwfpqys|xmngfoerny|jrpbnulpox|dpsqoauwnm|rauugjkijg|ollwsllkqs|kvnikdxeph|cuwllwndam|bkrijtslix|wuwjssnhjt|gmcraaparp|fjhoonafof|eufttbynsp|axfbvrfddk|dkdfxxqbxf|fqwbljbgmh|jqwamoqnrh|mefhlhkigy|yooqjnroiu|iaooxoaipe|lusglgaysi|oufkboxjnf|bcvtqsyrbw|wrijmpchex|usbedqodtq|uvqdqdkyse|dfouomesrt|khvcwpbwgg|wkldupuafq|jcbdxmsubk|nrgojtequh|vkfvrxtklp|gkpjfvsuwd|ktyflbwbmh|rfecruligy|ufhrnyakqf|hqyqhupmol|xlokvsfkah|soqbgydpxm|xtonuesqvg|hlwyjdmkfd|vwsifvbbff|hqruytxtlv|jfykspsvrm|tbauhtygkk|fquhewgbdb|oyybyrelad|qtccfyrcgs|cbrwxeowqq|wfoqdpybil|ikanvyvjmm|tqeqmaufol|wvujwtcnah|olapskhbpj|stfovrpsfe|blvrbrupjk|ofacjnjqbo|tclgntfagf|xbseencenh|kthsdhprsq|tfpajwfgjs|wbhklegkwy|nrqsshpuwl|jtkpbwyruo|xbvjyeptje|cbhhlmgnhc|ueuhgmnbpe|tjqrxnykrt|hdnxaktmib|ulgxqqxuhq|djlwgjoncp|bewccrvvwk|gwugxhfash|oonbpqpouj|hdilbbrgeo|bsqnetaheb|gaoyyttudo|aapupxyxoa|fpamqvwvgv|rvdmbvbvde|mtkxdyajpy|xoajfcbxmb|qflgiwqgfb|qcjeevkpuv|iontkfrobc|ncpwklekjw|pqhytepvxr|iyxkvcncud|tnqgxplmdb|agwbspfopi|wckdutjygo|priunngtip|qpiprdyjnw|ksjgdjlgdw|fefxhsdnut|ahfubmxgps|vvnekomybk|kdvqllyqpu|hbfsnuikpl|ahkebjwssv|qyuitbvfis|uqbaxujbiq|vpxrirabal|ntdequjjwj|wqstmjuygy|iocgjwalgg|ojvevginrc|iafnlktqal|mjpynjnydj|fccequfmhy|onymdbdxuf|bxpwdrxnis|raivofactb|uqampwtwob|haicwqbpqf|rwqpkdcbsj|hnpjspdpjj|maedfwfiow|smqigfjfxi|pqgkcjydcm|tujevpuuli|sujvoiwohs|hqfwgohvwq|auwjikxtha|rrkccxyxky|dvvgdwkenb|ldnsbuiaup|ineipkhohb|rddfnjadgt|makluthjim|ymgvbdimnx|djqyumugkn|wplsmntryf|kjukmfwwji|fnxbopikau|pfboshiqbg|yluoljqghf|taptwfnpnw|gnqnsuttjy|jlfscwefty|heucdpmecn|ihvtsaybqn|loufssrhmd|xxpvtbnrxl|mslcvkyptu|scfksirfus|coasnpqbal|frpifjsmhm|oyrsxupppa|gtmxstmxgw|lccbddnnxf|nsvtputckc|ipqfitwaug|oesowuyhec|mpvjqrovvj|xxnrgytkal|mgjxiypeqt|pqcdouxabn|dtneacihbl|cjkkvfskdf|gqqkfmujtg|idasgwdylf|mtmbwnwhrf|febkulwcwd|udgappxnfc|oeounuhwho|sjpqtqrlpv|pagnwrxrps|qqrwiuthuk|ijmjsqqctu|sqbctxhqne|mxvdkrcswp|wcqorskhol|fwgegcvyec|iorwpkftgx|rjnrhluhci|twyktwpkkk|jcvnnqxela|npmnauyenx|fmjifmxmga|nagwfhcnpq|bsicplsatb|atphmlaoti|owoagpdhvv|okeajpbnml|ukugrdjpet|rlgpjsyaje|rcdoecobqx|wikoprekab|hhhjlawjis|eqfgphcyhk|miablyqdsg|uqgjqnclce|ynjeaqhhvj|pcchimuvyc|karmvhawrd|upavyhppju|hxbpptxgir|kcrneyprmt|dneeaxevhr|ptxonkmnvo|tofaghvfya|asxkecbpgq|keofkhhidm|ygfcouswlh|rkpborjnhw|bjvmvvayqv|boqvpyuqyx|jjitbhfabt|rlmqtiyefm|grbkccnwjb|cxilkyoaqe|nytoiomruk|wkhaxwvsig|mkmqouhlux|kxqybgmbvd|gyohmkaghk|nosthntnpc|eecfofhkey|otaftyplld|qwdbbvvpae|dchthgxlkt|kedssfykwf|iefptayfoj|xvflxsflyy|dkfunrmbml|hklmsgmebu|fcirkivtaw|kpkeherygc|tegoqadwhs|ouajtcnaex|fpuxxupevj|suwajflhib|mxpjkxtpiv|wvixbjmqxx|kxskivawug|ogurbgvlxc|mrpvryjxho|qtregjalbx|dpttetgwab|ivrepttkad|xwtekkgmmg|goncgoetoo|xtmebvdmnt|avwxmhxlmt|mblpkonkru|octdffpxvi|cphaimnkem|pgqkixhkrm|neweqlvykv|rwpaxtvvcd|meoeqvikvf|sesidaswum|lnvflqrsut|acxdeigusf|axespcbupb|jnfmaarrwu|vtxrrjbvbi|ahvtdtqgeb|tulgfqygrd|mrjaalwnry|ygrubyjsbe|hppeeiysix|anejrvremq|uimvbkbguk|yvmenqbdyt|pfqofbbexs|nvafvegcmx|ebrcndduai|gyirklbcgq|gurtqinfyx|naxqjcbpaw|drwquymxmo|gkpewoxsxd|unrtnfsamm|lbaaytsmoc|xtbseujdgw|oigdahqrfg|vmkvdsnxsa|udwyblgvvg|wceowsfods|fghfcpkisi|frljvpjaug|akvggmvlir|rerlxfvsjg|vbtderkpoi|xajswoxdfk|kehfcqgiwe|juyadrkyla|olulyxbatd|elotjjgfqn|vxvpaqlxed|qtauqxvyei|fjcnklrisf|snmesqlwhg|qyoukmdqmj|qcadvxkmee|owwpkwwkyh|botpindxwv|kkwjxbmfsc|cwynvaodvp|iftehefeeq|ofgdiwxphw|iwobhhslvy|aqjldssjbw|mmphapfpfw|sugbfunmgr|aikbnbspwv|frhxurmxld|wivoakyeve|esmlvkoeom|qhivtruvyr|swqadbqalh|iryygfbedr|aaoebkeoyr|hkxaucfnnq|gkcuwtucbc|flodjmegvp|lfbvpaolbu|tarrpxddqa|frkhgcfuqv|vjoeaoyeno|krqssjimfr|tsyflxeijs|tylqhkwaas|jtlmqxdnjt|ubqfchijhx|bjeydheeij|tuanpfdwwk|tyqfdrjpdj|hbtcpwygkq|dfcxtkuqaa|xsqfsjafdg|rieypwriub|gbsckpuqut|aacrtfuwpl|kmdejtxjxa|egjlvhukcm|ulnkdmpycn|jqbtoxxcgo|cccmxkqdow|dsnjuekdbs|fbiagfpxfg|lrqhhmonth|oemdeiarih|bfjufckwkw|hofetwrjtg|wjhnenwnxc|mpaexvbqxr|lwpvpafxej|kcmaahkykh|rmpbqaaffn|qljnmfcloc|ippvtsxbod|bdvueubwmi|iedcgpjgpr|dfvhvnwoyy|owrupuccbw|htswogsaag|cxjqvygxlq|pojmgslclk|slrjasubwl|ytxwcophfu|gaappkktuu|xcjheivnkb|yclmegwinr|gmgtibralg|hbbyhdgvgd|iqqxhgljlq|ioafsqlube|hurcahkfvr|sxlnfqfinr|pmmstdviqb|pbdhumkbqm|plbnummold|wsekvwumls|xkrowadmri|wqtpyxskkc|ksqvlhsojv|tshxulebut|ifwwvaksgp|keqjwcoaaf|txxxhoagmd|akrltggutp|bjqbkhubnr|qoqficdvmb|mimaublaih|obeqslvrpo|cxhhqhiyls|grvohirlnp|kehnofmsyg|fwclgrfefr|ytbfwqvtti|jknckpjvhn|okqwbysbow|oyypuobjin|jqkctlxmrw|enpnhvbehu|gkpsfnalwd|bpxtscthrw|sasnrnpwng|lgprxcajmn|ejhmxbuffq|nvuivrutbq|yitiodnnqt|mvkrmomisv|cxehbowcix|gxbkwvufbd|anvnfbhjbg|jbqttgbrbo|jljyujcucf|cjjenppbhq|cddbacgtur|bujctpjkyu|uphxoakjts|rtoqmbvdjy|bkvlprcyoo|jhwduvkgfq|rolmglkbgd|ueuebvnjde|hroisscxdh|vlsomwjfki|dakowybtvo|mpihrdtcvj|noybppfrnu|fqnmvxfoum|axgcleopvd|esuhnaillm|bsohidnmrg|qafwplsulf|ebhxeqarwh|gpcykuiapl|bhlqfuknbi|jelewrejnv|qfmbsuygki|kjkiavpjga|ymnryrmhyd|lqmobpncox|vpwvhjqhoy|lardapowjh|bocsopwnxs|htgstsuqfb|jqpknssjdl|huuosujkbv|pmcqlphghv|xfmfcuefnx|vdyvelvcng|suftgiquvn|yweryjgrwc|wjopiwjtrk|mscpeaqfvq|mlxmvhvkeo|fsghgqkvef|aidtwgbyyu|sjsoiggwya|prldgrxjhi|cqcooipxus|jylrqlbyie|yhatfowfuy|fsfqvpgsqg|phdabnjdgf|cgpddfdsvm|lrgdversqc|xdqfbdpcmx|mybvirnicf|fnmqudtjud|nvrqlrhgfx|dlxuhmwhqw|ivnvnnwwrr|qhexnienoa|xruvubmbll|tbcvvmyayr|omvvhspkja|gvtoyhells|wepknrkirs|tiuowenuix|yddslqnwxu|nvknwgnnar|ikxidbswff|aegcdpvwsm|bcpjcnjggt|fhietucpbd|buyhoamsds|eccsjgaatf|mxlgwfuaru|gfiewmswxm|awiiwejiqe|mersknkrcx|dtdpmdebes|ihwfyhoncn|gaatuovobu|xdbgpaopxu|ahoybbfivt|itpdyrqtny|lfuytlpxef|wwlllaetiq|lvuyexitpu|fuxovadtog|qtsqokhqul|mowlfmhqqr|eflxxpyoch|sdmoqvgvdk|uvyjknajsi|wqhwakjbxq|bqxgwdcffj|wvwshhjnho|legukwvsob|acbjtgubvy|pggmujexmn|uloalbeyko|kulyobpixh|hanmbcjfam|xwottiyehy|dkppvgieid|eqawetuddx|iuwyflqbve|kbuxirxoga|xblhlkugon|utqggdcesd|hgakyyhysh|nuneaaasko'.split('|'),0,{}))
+});
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-packer-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-packer-4.html
new file mode 100644
index 00000000000..422bcc2a814
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-packer-4.html
@@ -0,0 +1,33 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Unpack', onlyNum = 8;
+function thisTest() {
+
+startTest("real-packer");
+
+test("Unpack", 1, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="O";0 1="5";0 1="2";0 1="4";0 1="J";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="u";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="t";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="P";',52,52,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|wrijmpchex|lccbddnnxf|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|vmkvdsnxsa|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|hgakyyhysh|iereeyrdnh'.split('|'),0,{}))
+});
+
+test("Unpack", 2, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('1 0="1C";1 0="5";1 0="2";1 0="4";1 0="1v";1 0="6";1 0="7";1 0="8";1 0="3";1 0="a";1 0="b";1 0="c";1 0="10";1 0="d";1 0="f";1 0="g";1 0="h";1 0="i";1 0="j";1 0="k";1 0="9";1 0="m";1 0="n";1 0="o";1 0="p";1 0="q";1 0="r";1 0="s";1 0="Z";1 0="e";1 0="v";1 0="w";1 0="x";1 0="y";1 0="z";1 0="A";1 0="B";1 0="C";1 0="D";1 0="E";1 0="F";1 0="G";1 0="H";1 0="I";1 0="l";1 0="K";1 0="L";1 0="M";1 0="N";1 0="O";1 0="P";1 0="Q";1 0="R";1 0="S";1 0="T";1 0="U";1 0="V";1 0="W";1 0="X";1 0="Y";1 0="u";1 0="t";1 0="11";1 0="12";1 0="13";1 0="14";1 0="15";1 0="16";1 0="17";1 0="18";1 0="19";1 0="1a";1 0="1b";1 0="1c";1 0="1d";1 0="1e";1 0="1f";1 0="1g";1 0="1h";1 0="1i";1 0="1j";1 0="1k";1 0="1l";1 0="1m";1 0="1n";1 0="1o";1 0="1p";1 0="1q";1 0="1r";1 0="1s";1 0="1t";1 0="1u";1 0="J";1 0="1w";1 0="1x";1 0="1y";1 0="1z";1 0="1A";1 0="1B";1 0="1D";',62,102,'aaa|var|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|bcvtqsyrbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|wrijmpchex|lccbddnnxf|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|vmkvdsnxsa|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|hgakyyhysh|rsbgawetse'.split('|'),0,{}))
+});
+
+test("Unpack", 4, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="3e";0 1="5";0 1="2";0 1="4";0 1="33";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="22";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="21";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="O";0 1="P";0 1="Q";0 1="R";0 1="S";0 1="T";0 1="U";0 1="V";0 1="W";0 1="X";0 1="Y";0 1="10";0 1="t";0 1="11";0 1="12";0 1="13";0 1="14";0 1="15";0 1="16";0 1="17";0 1="18";0 1="19";0 1="1a";0 1="1b";0 1="1c";0 1="1d";0 1="1e";0 1="1f";0 1="1g";0 1="1h";0 1="1i";0 1="1j";0 1="1k";0 1="1l";0 1="1m";0 1="1n";0 1="1o";0 1="1p";0 1="1q";0 1="1r";0 1="1s";0 1="1t";0 1="1u";0 1="J";0 1="1w";0 1="1x";0 1="1y";0 1="1z";0 1="1A";0 1="1B";0 1="1C";0 1="1D";0 1="1E";0 1="1F";0 1="1G";0 1="1H";0 1="1I";0 1="1J";0 1="1K";0 1="1L";0 1="1M";0 1="1N";0 1="1O";0 1="1P";0 1="1Q";0 1="1R";0 1="1S";0 1="1T";0 1="1U";0 1="1V";0 1="1W";0 1="1X";0 1="1Y";0 1="1Z";0 1="20";0 1="Z";0 1="u";0 1="23";0 1="24";0 1="25";0 1="26";0 1="27";0 1="28";0 1="29";0 1="2a";0 1="2b";0 1="2c";0 1="2d";0 1="2e";0 1="2f";0 1="2g";0 1="2h";0 1="2i";0 1="2j";0 1="2k";0 1="2l";0 1="2m";0 1="2n";0 1="2o";0 1="2p";0 1="2q";0 1="2r";0 1="2s";0 1="2t";0 1="2u";0 1="2v";0 1="2w";0 1="2x";0 1="2y";0 1="2z";0 1="2A";0 1="2B";0 1="2C";0 1="2D";0 1="2E";0 1="2F";0 1="2G";0 1="2H";0 1="2I";0 1="2J";0 1="2K";0 1="2L";0 1="2M";0 1="2N";0 1="2O";0 1="2P";0 1="2Q";0 1="2R";0 1="2S";0 1="2T";0 1="2U";0 1="2V";0 1="2W";0 1="2X";0 1="2Y";0 1="2Z";0 1="30";0 1="31";0 1="32";0 1="1v";0 1="34";0 1="35";0 1="36";0 1="37";0 1="38";0 1="39";0 1="3a";0 1="3b";0 1="3c";0 1="3d";0 1="3f";',62,202,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|klucopuyfg|bcvtqsyrbw|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|wrijmpchex|lccbddnnxf|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|vmkvdsnxsa|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|hgakyyhysh|prrrrbwosb'.split('|'),0,{}))
+});
+
+test("Unpack", 8, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="5E";0 1="5";0 1="2";0 1="4";0 1="45";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="33";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="22";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="O";0 1="P";0 1="Q";0 1="R";0 1="S";0 1="T";0 1="U";0 1="V";0 1="W";0 1="X";0 1="Y";0 1="21";0 1="t";0 1="11";0 1="12";0 1="13";0 1="14";0 1="15";0 1="16";0 1="17";0 1="18";0 1="19";0 1="1a";0 1="1b";0 1="1c";0 1="1d";0 1="1e";0 1="1f";0 1="1g";0 1="1h";0 1="1i";0 1="1j";0 1="1k";0 1="1l";0 1="1m";0 1="1n";0 1="1o";0 1="1p";0 1="1q";0 1="1r";0 1="1s";0 1="1t";0 1="1u";0 1="J";0 1="1w";0 1="1x";0 1="1y";0 1="1z";0 1="1A";0 1="1B";0 1="1C";0 1="1D";0 1="1E";0 1="1F";0 1="1G";0 1="1H";0 1="1I";0 1="1J";0 1="1K";0 1="1L";0 1="1M";0 1="1N";0 1="1O";0 1="1P";0 1="1Q";0 1="1R";0 1="1S";0 1="1T";0 1="1U";0 1="1V";0 1="1W";0 1="1X";0 1="1Y";0 1="1Z";0 1="20";0 1="10";0 1="u";0 1="23";0 1="24";0 1="25";0 1="26";0 1="27";0 1="28";0 1="29";0 1="2a";0 1="2b";0 1="2c";0 1="2d";0 1="2e";0 1="2f";0 1="2g";0 1="2h";0 1="2i";0 1="2j";0 1="2k";0 1="2l";0 1="2m";0 1="2n";0 1="2o";0 1="2p";0 1="2q";0 1="2r";0 1="2s";0 1="2t";0 1="2u";0 1="2v";0 1="2w";0 1="2x";0 1="2y";0 1="2z";0 1="2A";0 1="2B";0 1="2C";0 1="2D";0 1="2E";0 1="2F";0 1="2G";0 1="2H";0 1="2I";0 1="2J";0 1="2K";0 1="2L";0 1="2M";0 1="2N";0 1="2O";0 1="2P";0 1="2Q";0 1="2R";0 1="2S";0 1="2T";0 1="2U";0 1="2V";0 1="2W";0 1="2X";0 1="2Y";0 1="2Z";0 1="30";0 1="31";0 1="32";0 1="1v";0 1="34";0 1="35";0 1="36";0 1="37";0 1="38";0 1="39";0 1="3a";0 1="3b";0 1="3c";0 1="3d";0 1="3e";0 1="3f";0 1="3g";0 1="3h";0 1="3i";0 1="3j";0 1="3k";0 1="3l";0 1="3m";0 1="3n";0 1="3o";0 1="3p";0 1="3q";0 1="3r";0 1="3s";0 1="3t";0 1="3u";0 1="3v";0 1="3w";0 1="3x";0 1="3y";0 1="3z";0 1="3A";0 1="3B";0 1="3C";0 1="3D";0 1="3E";0 1="3F";0 1="3G";0 1="3H";0 1="3I";0 1="3J";0 1="3K";0 1="3L";0 1="3M";0 1="3N";0 1="3O";0 1="3P";0 1="3Q";0 1="3R";0 1="3S";0 1="3T";0 1="3U";0 1="3V";0 1="3W";0 1="3X";0 1="3Y";0 1="3Z";0 1="40";0 1="41";0 1="42";0 1="43";0 1="44";0 1="Z";0 1="46";0 1="47";0 1="48";0 1="49";0 1="4a";0 1="4b";0 1="4c";0 1="4d";0 1="4e";0 1="4f";0 1="4g";0 1="4h";0 1="4i";0 1="4j";0 1="4k";0 1="4l";0 1="4m";0 1="4n";0 1="4o";0 1="4p";0 1="4q";0 1="4r";0 1="4s";0 1="4t";0 1="4u";0 1="4v";0 1="4w";0 1="4x";0 1="4y";0 1="4z";0 1="4A";0 1="4B";0 1="4C";0 1="4D";0 1="4E";0 1="4F";0 1="4G";0 1="4H";0 1="4I";0 1="4J";0 1="4K";0 1="4L";0 1="4M";0 1="4N";0 1="4O";0 1="4P";0 1="4Q";0 1="4R";0 1="4S";0 1="4T";0 1="4U";0 1="4V";0 1="4W";0 1="4X";0 1="4Y";0 1="4Z";0 1="50";0 1="51";0 1="52";0 1="53";0 1="54";0 1="55";0 1="56";0 1="57";0 1="58";0 1="59";0 1="5a";0 1="5b";0 1="5c";0 1="5d";0 1="5e";0 1="5f";0 1="5g";0 1="5h";0 1="5i";0 1="5j";0 1="5k";0 1="5l";0 1="5m";0 1="5n";0 1="5o";0 1="5p";0 1="5q";0 1="5r";0 1="5s";0 1="5t";0 1="5u";0 1="5v";0 1="5w";0 1="5x";0 1="5y";0 1="5z";0 1="5A";0 1="5B";0 1="5C";0 1="5D";0 1="5F";',62,352,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|kgrufshhbi|klucopuyfg|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|bcvtqsyrbw|wrijmpchex|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|lccbddnnxf|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|prrrrbwosb|eixeiqnpio|klwbiuhskx|yommhlpsuv|lwswqksvjf|gyrwjmamam|qqetupasqh|gwqvowymto|wybagnxuqd|djsqhkplsc|hlqrgvlpxs|qifaiqysrk|fyehbjrvni|pdjgenegvl|kjitkvolqr|ferdukxfks|rpiewigpby|akefenlgif|klbmmuwpyd|jnyltfmttp|lujysqvawj|hhvjmofslr|wdaatluhox|fqhbhwqbmr|ggurrkfxov|wjffwansnv|esjiemwyad|tqgmsangoe|rlpulmorwi|nnxcuhnckd|ctsembjxcf|aangwfpqys|xmngfoerny|jrpbnulpox|dpsqoauwnm|rauugjkijg|ollwsllkqs|kvnikdxeph|cuwllwndam|bkrijtslix|wuwjssnhjt|gmcraaparp|fjhoonafof|eufttbynsp|axfbvrfddk|dkdfxxqbxf|fqwbljbgmh|jqwamoqnrh|mefhlhkigy|yooqjnroiu|iaooxoaipe|lusglgaysi|oufkboxjnf|vmkvdsnxsa|breagupopf|usbedqodtq|uvqdqdkyse|dfouomesrt|khvcwpbwgg|wkldupuafq|jcbdxmsubk|nrgojtequh|vkfvrxtklp|gkpjfvsuwd|ktyflbwbmh|rfecruligy|ufhrnyakqf|hqyqhupmol|xlokvsfkah|soqbgydpxm|xtonuesqvg|hlwyjdmkfd|vwsifvbbff|hqruytxtlv|jfykspsvrm|tbauhtygkk|fquhewgbdb|oyybyrelad|qtccfyrcgs|cbrwxeowqq|wfoqdpybil|ikanvyvjmm|tqeqmaufol|wvujwtcnah|olapskhbpj|stfovrpsfe|blvrbrupjk|ofacjnjqbo|tclgntfagf|xbseencenh|kthsdhprsq|tfpajwfgjs|wbhklegkwy|nrqsshpuwl|jtkpbwyruo|xbvjyeptje|cbhhlmgnhc|ueuhgmnbpe|tjqrxnykrt|hdnxaktmib|ulgxqqxuhq|djlwgjoncp|bewccrvvwk|gwugxhfash|oonbpqpouj|hdilbbrgeo|bsqnetaheb|gaoyyttudo|aapupxyxoa|fpamqvwvgv|rvdmbvbvde|mtkxdyajpy|xoajfcbxmb|qflgiwqgfb|qcjeevkpuv|iontkfrobc|ncpwklekjw|pqhytepvxr|iyxkvcncud|tnqgxplmdb|agwbspfopi|wckdutjygo|priunngtip|qpiprdyjnw|ksjgdjlgdw|fefxhsdnut|ahfubmxgps|vvnekomybk|kdvqllyqpu|hbfsnuikpl|ahkebjwssv|qyuitbvfis|uqbaxujbiq|vpxrirabal|ntdequjjwj|wqstmjuygy|iocgjwalgg|ojvevginrc|iafnlktqal|mjpynjnydj|fccequfmhy|onymdbdxuf|bxpwdrxnis|raivofactb|uqampwtwob|haicwqbpqf|rwqpkdcbsj|hnpjspdpjj|maedfwfiow|smqigfjfxi|hgakyyhysh|pqgkcjydcm'.split('|'),0,{}))
+});
+
+test("Unpack", 16, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('1 0="c6";1 0="5";1 0="2";1 0="4";1 0="8d";1 0="6";1 0="7";1 0="8";1 0="3";1 0="a";1 0="b";1 0="c";1 0="69";1 0="d";1 0="f";1 0="g";1 0="h";1 0="i";1 0="j";1 0="k";1 0="9";1 0="m";1 0="n";1 0="o";1 0="p";1 0="q";1 0="r";1 0="s";1 0="46";1 0="e";1 0="v";1 0="w";1 0="x";1 0="y";1 0="z";1 0="A";1 0="B";1 0="C";1 0="D";1 0="E";1 0="F";1 0="G";1 0="H";1 0="I";1 0="l";1 0="K";1 0="L";1 0="M";1 0="N";1 0="O";1 0="P";1 0="Q";1 0="R";1 0="S";1 0="T";1 0="U";1 0="V";1 0="W";1 0="X";1 0="Y";1 0="45";1 0="t";1 0="11";1 0="12";1 0="13";1 0="14";1 0="15";1 0="16";1 0="17";1 0="18";1 0="19";1 0="1a";1 0="1b";1 0="1c";1 0="1d";1 0="1e";1 0="1f";1 0="1g";1 0="1h";1 0="1i";1 0="1j";1 0="1k";1 0="1l";1 0="1m";1 0="1n";1 0="1o";1 0="1p";1 0="1q";1 0="1r";1 0="1s";1 0="1t";1 0="1u";1 0="J";1 0="1w";1 0="1x";1 0="1y";1 0="1z";1 0="1A";1 0="1B";1 0="1C";1 0="1D";1 0="1E";1 0="1F";1 0="1G";1 0="1H";1 0="1I";1 0="1J";1 0="1K";1 0="1L";1 0="1M";1 0="1N";1 0="1O";1 0="1P";1 0="1Q";1 0="1R";1 0="1S";1 0="1T";1 0="1U";1 0="1V";1 0="1W";1 0="1X";1 0="1Y";1 0="1Z";1 0="20";1 0="22";1 0="u";1 0="23";1 0="24";1 0="25";1 0="26";1 0="27";1 0="28";1 0="29";1 0="2a";1 0="2b";1 0="2c";1 0="2d";1 0="2e";1 0="2f";1 0="2g";1 0="2h";1 0="2i";1 0="2j";1 0="2k";1 0="2l";1 0="2m";1 0="2n";1 0="2o";1 0="2p";1 0="2q";1 0="2r";1 0="2s";1 0="2t";1 0="2u";1 0="2v";1 0="2w";1 0="2x";1 0="2y";1 0="2z";1 0="2A";1 0="2B";1 0="2C";1 0="2D";1 0="2E";1 0="2F";1 0="2G";1 0="2H";1 0="2I";1 0="2J";1 0="2K";1 0="2L";1 0="2M";1 0="2N";1 0="2O";1 0="2P";1 0="2Q";1 0="2R";1 0="2S";1 0="2T";1 0="2U";1 0="2V";1 0="2W";1 0="2X";1 0="2Y";1 0="2Z";1 0="30";1 0="31";1 0="32";1 0="1v";1 0="34";1 0="35";1 0="36";1 0="37";1 0="38";1 0="39";1 0="3a";1 0="3b";1 0="3c";1 0="3d";1 0="3e";1 0="3f";1 0="3g";1 0="3h";1 0="3i";1 0="3j";1 0="3k";1 0="3l";1 0="3m";1 0="3n";1 0="3o";1 0="3p";1 0="3q";1 0="3r";1 0="3s";1 0="3t";1 0="3u";1 0="3v";1 0="3w";1 0="3x";1 0="3y";1 0="3z";1 0="3A";1 0="3B";1 0="3C";1 0="3D";1 0="3E";1 0="3F";1 0="3G";1 0="3H";1 0="3I";1 0="3J";1 0="3K";1 0="3L";1 0="3M";1 0="3N";1 0="3O";1 0="3P";1 0="3Q";1 0="3R";1 0="3S";1 0="3T";1 0="3U";1 0="3V";1 0="3W";1 0="3X";1 0="3Y";1 0="3Z";1 0="40";1 0="41";1 0="42";1 0="43";1 0="44";1 0="21";1 0="Z";1 0="47";1 0="48";1 0="49";1 0="4a";1 0="4b";1 0="4c";1 0="4d";1 0="4e";1 0="4f";1 0="4g";1 0="4h";1 0="4i";1 0="4j";1 0="4k";1 0="4l";1 0="4m";1 0="4n";1 0="4o";1 0="4p";1 0="4q";1 0="4r";1 0="4s";1 0="4t";1 0="4u";1 0="4v";1 0="4w";1 0="4x";1 0="4y";1 0="4z";1 0="4A";1 0="4B";1 0="4C";1 0="4D";1 0="4E";1 0="4F";1 0="4G";1 0="4H";1 0="4I";1 0="4J";1 0="4K";1 0="4L";1 0="4M";1 0="4N";1 0="4O";1 0="4P";1 0="4Q";1 0="4R";1 0="4S";1 0="4T";1 0="4U";1 0="4V";1 0="4W";1 0="4X";1 0="4Y";1 0="4Z";1 0="50";1 0="51";1 0="52";1 0="53";1 0="54";1 0="55";1 0="56";1 0="57";1 0="58";1 0="59";1 0="5a";1 0="5b";1 0="5c";1 0="5d";1 0="5e";1 0="5f";1 0="5g";1 0="5h";1 0="5i";1 0="5j";1 0="5k";1 0="5l";1 0="5m";1 0="5n";1 0="5o";1 0="5p";1 0="5q";1 0="5r";1 0="5s";1 0="5t";1 0="5u";1 0="5v";1 0="5w";1 0="5x";1 0="5y";1 0="5z";1 0="5A";1 0="5B";1 0="5C";1 0="5D";1 0="5E";1 0="5F";1 0="5G";1 0="5H";1 0="5I";1 0="5J";1 0="5K";1 0="5L";1 0="5M";1 0="5N";1 0="5O";1 0="5P";1 0="5Q";1 0="5R";1 0="5S";1 0="5T";1 0="5U";1 0="5V";1 0="5W";1 0="5X";1 0="5Y";1 0="5Z";1 0="60";1 0="61";1 0="62";1 0="63";1 0="64";1 0="65";1 0="66";1 0="67";1 0="68";1 0="33";1 0="6a";1 0="6b";1 0="6c";1 0="6d";1 0="6e";1 0="6f";1 0="6g";1 0="6h";1 0="6i";1 0="6j";1 0="6k";1 0="6l";1 0="6m";1 0="6n";1 0="6o";1 0="6p";1 0="6q";1 0="6r";1 0="6s";1 0="6t";1 0="6u";1 0="6v";1 0="6w";1 0="6x";1 0="6y";1 0="6z";1 0="6A";1 0="6B";1 0="6C";1 0="6D";1 0="6E";1 0="6F";1 0="6G";1 0="6H";1 0="6I";1 0="6J";1 0="6K";1 0="6L";1 0="6M";1 0="6N";1 0="6O";1 0="6P";1 0="6Q";1 0="6R";1 0="6S";1 0="6T";1 0="6U";1 0="6V";1 0="6W";1 0="6X";1 0="6Y";1 0="6Z";1 0="70";1 0="71";1 0="72";1 0="73";1 0="74";1 0="75";1 0="76";1 0="77";1 0="78";1 0="79";1 0="7a";1 0="7b";1 0="7c";1 0="7d";1 0="7e";1 0="7f";1 0="7g";1 0="7h";1 0="7i";1 0="7j";1 0="7k";1 0="7l";1 0="7m";1 0="7n";1 0="7o";1 0="7p";1 0="7q";1 0="7r";1 0="7s";1 0="7t";1 0="7u";1 0="7v";1 0="7w";1 0="7x";1 0="7y";1 0="7z";1 0="7A";1 0="7B";1 0="7C";1 0="7D";1 0="7E";1 0="7F";1 0="7G";1 0="7H";1 0="7I";1 0="7J";1 0="7K";1 0="7L";1 0="7M";1 0="7N";1 0="7O";1 0="7P";1 0="7Q";1 0="7R";1 0="7S";1 0="7T";1 0="7U";1 0="7V";1 0="7W";1 0="7X";1 0="7Y";1 0="7Z";1 0="80";1 0="81";1 0="82";1 0="83";1 0="84";1 0="85";1 0="86";1 0="87";1 0="88";1 0="89";1 0="8a";1 0="8b";1 0="8c";1 0="10";1 0="8e";1 0="8f";1 0="8g";1 0="8h";1 0="8i";1 0="8j";1 0="8k";1 0="8l";1 0="8m";1 0="8n";1 0="8o";1 0="8p";1 0="8q";1 0="8r";1 0="8s";1 0="8t";1 0="8u";1 0="8v";1 0="8w";1 0="8x";1 0="8y";1 0="8z";1 0="8A";1 0="8B";1 0="8C";1 0="8D";1 0="8E";1 0="8F";1 0="8G";1 0="8H";1 0="8I";1 0="8J";1 0="8K";1 0="8L";1 0="8M";1 0="8N";1 0="8O";1 0="8P";1 0="8Q";1 0="8R";1 0="8S";1 0="8T";1 0="8U";1 0="8V";1 0="8W";1 0="8X";1 0="8Y";1 0="8Z";1 0="90";1 0="91";1 0="92";1 0="93";1 0="94";1 0="95";1 0="96";1 0="97";1 0="98";1 0="99";1 0="9a";1 0="9b";1 0="9c";1 0="9d";1 0="9e";1 0="9f";1 0="9g";1 0="9h";1 0="9i";1 0="9j";1 0="9k";1 0="9l";1 0="9m";1 0="9n";1 0="9o";1 0="9p";1 0="9q";1 0="9r";1 0="9s";1 0="9t";1 0="9u";1 0="9v";1 0="9w";1 0="9x";1 0="9y";1 0="9z";1 0="9A";1 0="9B";1 0="9C";1 0="9D";1 0="9E";1 0="9F";1 0="9G";1 0="9H";1 0="9I";1 0="9J";1 0="9K";1 0="9L";1 0="9M";1 0="9N";1 0="9O";1 0="9P";1 0="9Q";1 0="9R";1 0="9S";1 0="9T";1 0="9U";1 0="9V";1 0="9W";1 0="9X";1 0="9Y";1 0="9Z";1 0="a0";1 0="a1";1 0="a2";1 0="a3";1 0="a4";1 0="a5";1 0="a6";1 0="a7";1 0="a8";1 0="a9";1 0="aa";1 0="ab";1 0="ac";1 0="ad";1 0="ae";1 0="af";1 0="ag";1 0="ah";1 0="ai";1 0="aj";1 0="ak";1 0="al";1 0="am";1 0="an";1 0="ao";1 0="ap";1 0="aq";1 0="ar";1 0="as";1 0="at";1 0="au";1 0="av";1 0="aw";1 0="ax";1 0="ay";1 0="az";1 0="aA";1 0="aB";1 0="aC";1 0="aD";1 0="aE";1 0="aF";1 0="aG";1 0="aH";1 0="aI";1 0="aJ";1 0="aK";1 0="aL";1 0="aM";1 0="aN";1 0="aO";1 0="aP";1 0="aQ";1 0="aR";1 0="aS";1 0="aT";1 0="aU";1 0="aV";1 0="aW";1 0="aX";1 0="aY";1 0="aZ";1 0="b0";1 0="b1";1 0="b2";1 0="b3";1 0="b4";1 0="b5";1 0="b6";1 0="b7";1 0="b8";1 0="b9";1 0="ba";1 0="bb";1 0="bc";1 0="bd";1 0="be";1 0="bf";1 0="bg";1 0="bh";1 0="bi";1 0="bj";1 0="bk";1 0="bl";1 0="bm";1 0="bn";1 0="bo";1 0="bp";1 0="bq";1 0="br";1 0="bs";1 0="bt";1 0="bu";1 0="bv";1 0="bw";1 0="bx";1 0="by";1 0="bz";1 0="bA";1 0="bB";1 0="bC";1 0="bD";1 0="bE";1 0="bF";1 0="bG";1 0="bH";1 0="bI";1 0="bJ";1 0="bK";1 0="bL";1 0="bM";1 0="bN";1 0="bO";1 0="bP";1 0="bQ";1 0="bR";1 0="bS";1 0="bT";1 0="bU";1 0="bV";1 0="bW";1 0="bX";1 0="bY";1 0="bZ";1 0="c0";1 0="c1";1 0="c2";1 0="c3";1 0="c4";1 0="c5";1 0="c7";',62,752,'aaa|var|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|breagupopf|werjimrcgo|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|kgrufshhbi|klucopuyfg|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|vsxvrorijn|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|prrrrbwosb|eixeiqnpio|klwbiuhskx|yommhlpsuv|lwswqksvjf|gyrwjmamam|qqetupasqh|gwqvowymto|wybagnxuqd|djsqhkplsc|hlqrgvlpxs|qifaiqysrk|fyehbjrvni|pdjgenegvl|kjitkvolqr|ferdukxfks|rpiewigpby|akefenlgif|klbmmuwpyd|jnyltfmttp|lujysqvawj|hhvjmofslr|wdaatluhox|fqhbhwqbmr|ggurrkfxov|wjffwansnv|esjiemwyad|tqgmsangoe|rlpulmorwi|nnxcuhnckd|ctsembjxcf|aangwfpqys|xmngfoerny|jrpbnulpox|dpsqoauwnm|rauugjkijg|ollwsllkqs|kvnikdxeph|cuwllwndam|bkrijtslix|wuwjssnhjt|gmcraaparp|fjhoonafof|eufttbynsp|axfbvrfddk|dkdfxxqbxf|fqwbljbgmh|jqwamoqnrh|mefhlhkigy|yooqjnroiu|iaooxoaipe|lusglgaysi|oufkboxjnf|bcvtqsyrbw|wrijmpchex|usbedqodtq|uvqdqdkyse|dfouomesrt|khvcwpbwgg|wkldupuafq|jcbdxmsubk|nrgojtequh|vkfvrxtklp|gkpjfvsuwd|ktyflbwbmh|rfecruligy|ufhrnyakqf|hqyqhupmol|xlokvsfkah|soqbgydpxm|xtonuesqvg|hlwyjdmkfd|vwsifvbbff|hqruytxtlv|jfykspsvrm|tbauhtygkk|fquhewgbdb|oyybyrelad|qtccfyrcgs|cbrwxeowqq|wfoqdpybil|ikanvyvjmm|tqeqmaufol|wvujwtcnah|olapskhbpj|stfovrpsfe|blvrbrupjk|ofacjnjqbo|tclgntfagf|xbseencenh|kthsdhprsq|tfpajwfgjs|wbhklegkwy|nrqsshpuwl|jtkpbwyruo|xbvjyeptje|cbhhlmgnhc|ueuhgmnbpe|tjqrxnykrt|hdnxaktmib|ulgxqqxuhq|djlwgjoncp|bewccrvvwk|gwugxhfash|oonbpqpouj|hdilbbrgeo|bsqnetaheb|gaoyyttudo|aapupxyxoa|fpamqvwvgv|rvdmbvbvde|mtkxdyajpy|xoajfcbxmb|qflgiwqgfb|qcjeevkpuv|iontkfrobc|ncpwklekjw|pqhytepvxr|iyxkvcncud|tnqgxplmdb|agwbspfopi|wckdutjygo|priunngtip|qpiprdyjnw|ksjgdjlgdw|fefxhsdnut|ahfubmxgps|vvnekomybk|kdvqllyqpu|hbfsnuikpl|ahkebjwssv|qyuitbvfis|uqbaxujbiq|vpxrirabal|ntdequjjwj|wqstmjuygy|iocgjwalgg|ojvevginrc|iafnlktqal|mjpynjnydj|fccequfmhy|onymdbdxuf|bxpwdrxnis|raivofactb|uqampwtwob|haicwqbpqf|rwqpkdcbsj|hnpjspdpjj|maedfwfiow|smqigfjfxi|pqgkcjydcm|tujevpuuli|sujvoiwohs|hqfwgohvwq|auwjikxtha|rrkccxyxky|dvvgdwkenb|ldnsbuiaup|ineipkhohb|rddfnjadgt|makluthjim|ymgvbdimnx|djqyumugkn|wplsmntryf|kjukmfwwji|fnxbopikau|pfboshiqbg|yluoljqghf|taptwfnpnw|gnqnsuttjy|jlfscwefty|heucdpmecn|ihvtsaybqn|loufssrhmd|xxpvtbnrxl|mslcvkyptu|scfksirfus|coasnpqbal|frpifjsmhm|oyrsxupppa|gtmxstmxgw|lccbddnnxf|nsvtputckc|ipqfitwaug|oesowuyhec|mpvjqrovvj|xxnrgytkal|mgjxiypeqt|pqcdouxabn|dtneacihbl|cjkkvfskdf|gqqkfmujtg|idasgwdylf|mtmbwnwhrf|febkulwcwd|udgappxnfc|oeounuhwho|sjpqtqrlpv|pagnwrxrps|qqrwiuthuk|ijmjsqqctu|sqbctxhqne|mxvdkrcswp|wcqorskhol|fwgegcvyec|iorwpkftgx|rjnrhluhci|twyktwpkkk|jcvnnqxela|npmnauyenx|fmjifmxmga|nagwfhcnpq|bsicplsatb|atphmlaoti|owoagpdhvv|okeajpbnml|ukugrdjpet|rlgpjsyaje|rcdoecobqx|wikoprekab|hhhjlawjis|eqfgphcyhk|miablyqdsg|uqgjqnclce|ynjeaqhhvj|pcchimuvyc|karmvhawrd|upavyhppju|hxbpptxgir|kcrneyprmt|dneeaxevhr|ptxonkmnvo|tofaghvfya|asxkecbpgq|keofkhhidm|ygfcouswlh|rkpborjnhw|bjvmvvayqv|boqvpyuqyx|jjitbhfabt|rlmqtiyefm|grbkccnwjb|cxilkyoaqe|nytoiomruk|wkhaxwvsig|mkmqouhlux|kxqybgmbvd|gyohmkaghk|nosthntnpc|eecfofhkey|otaftyplld|qwdbbvvpae|dchthgxlkt|kedssfykwf|iefptayfoj|xvflxsflyy|dkfunrmbml|hklmsgmebu|fcirkivtaw|kpkeherygc|tegoqadwhs|ouajtcnaex|fpuxxupevj|suwajflhib|mxpjkxtpiv|wvixbjmqxx|kxskivawug|ogurbgvlxc|mrpvryjxho|qtregjalbx|dpttetgwab|ivrepttkad|xwtekkgmmg|goncgoetoo|xtmebvdmnt|avwxmhxlmt|mblpkonkru|octdffpxvi|cphaimnkem|pgqkixhkrm|neweqlvykv|rwpaxtvvcd|meoeqvikvf|sesidaswum|lnvflqrsut|acxdeigusf|axespcbupb|jnfmaarrwu|vtxrrjbvbi|ahvtdtqgeb|tulgfqygrd|mrjaalwnry|ygrubyjsbe|hppeeiysix|anejrvremq|uimvbkbguk|yvmenqbdyt|pfqofbbexs|nvafvegcmx|ebrcndduai|gyirklbcgq|gurtqinfyx|naxqjcbpaw|drwquymxmo|gkpewoxsxd|unrtnfsamm|lbaaytsmoc|xtbseujdgw|oigdahqrfg|vmkvdsnxsa|udwyblgvvg|wceowsfods|fghfcpkisi|frljvpjaug|akvggmvlir|rerlxfvsjg|vbtderkpoi|xajswoxdfk|kehfcqgiwe|juyadrkyla|olulyxbatd|elotjjgfqn|vxvpaqlxed|qtauqxvyei|fjcnklrisf|snmesqlwhg|qyoukmdqmj|qcadvxkmee|owwpkwwkyh|botpindxwv|kkwjxbmfsc|cwynvaodvp|iftehefeeq|ofgdiwxphw|iwobhhslvy|aqjldssjbw|mmphapfpfw|sugbfunmgr|aikbnbspwv|frhxurmxld|wivoakyeve|esmlvkoeom|qhivtruvyr|swqadbqalh|iryygfbedr|aaoebkeoyr|hkxaucfnnq|gkcuwtucbc|flodjmegvp|lfbvpaolbu|tarrpxddqa|frkhgcfuqv|vjoeaoyeno|krqssjimfr|tsyflxeijs|tylqhkwaas|jtlmqxdnjt|ubqfchijhx|bjeydheeij|tuanpfdwwk|tyqfdrjpdj|hbtcpwygkq|dfcxtkuqaa|xsqfsjafdg|rieypwriub|gbsckpuqut|aacrtfuwpl|kmdejtxjxa|egjlvhukcm|ulnkdmpycn|jqbtoxxcgo|cccmxkqdow|dsnjuekdbs|fbiagfpxfg|lrqhhmonth|oemdeiarih|bfjufckwkw|hofetwrjtg|wjhnenwnxc|mpaexvbqxr|lwpvpafxej|kcmaahkykh|rmpbqaaffn|qljnmfcloc|ippvtsxbod|bdvueubwmi|iedcgpjgpr|dfvhvnwoyy|owrupuccbw|htswogsaag|cxjqvygxlq|pojmgslclk|slrjasubwl|ytxwcophfu|gaappkktuu|xcjheivnkb|yclmegwinr|gmgtibralg|hbbyhdgvgd|iqqxhgljlq|ioafsqlube|hurcahkfvr|sxlnfqfinr|pmmstdviqb|pbdhumkbqm|plbnummold|wsekvwumls|xkrowadmri|wqtpyxskkc|ksqvlhsojv|tshxulebut|ifwwvaksgp|keqjwcoaaf|txxxhoagmd|akrltggutp|bjqbkhubnr|qoqficdvmb|mimaublaih|obeqslvrpo|cxhhqhiyls|grvohirlnp|kehnofmsyg|fwclgrfefr|ytbfwqvtti|jknckpjvhn|okqwbysbow|oyypuobjin|jqkctlxmrw|enpnhvbehu|gkpsfnalwd|bpxtscthrw|sasnrnpwng|lgprxcajmn|ejhmxbuffq|nvuivrutbq|yitiodnnqt|mvkrmomisv|cxehbowcix|gxbkwvufbd|anvnfbhjbg|jbqttgbrbo|jljyujcucf|cjjenppbhq|cddbacgtur|bujctpjkyu|uphxoakjts|rtoqmbvdjy|bkvlprcyoo|jhwduvkgfq|rolmglkbgd|ueuebvnjde|hroisscxdh|vlsomwjfki|dakowybtvo|mpihrdtcvj|noybppfrnu|fqnmvxfoum|axgcleopvd|esuhnaillm|bsohidnmrg|qafwplsulf|ebhxeqarwh|gpcykuiapl|bhlqfuknbi|jelewrejnv|qfmbsuygki|kjkiavpjga|ymnryrmhyd|lqmobpncox|vpwvhjqhoy|lardapowjh|bocsopwnxs|htgstsuqfb|jqpknssjdl|huuosujkbv|pmcqlphghv|xfmfcuefnx|vdyvelvcng|suftgiquvn|yweryjgrwc|wjopiwjtrk|mscpeaqfvq|mlxmvhvkeo|fsghgqkvef|aidtwgbyyu|sjsoiggwya|prldgrxjhi|cqcooipxus|jylrqlbyie|yhatfowfuy|fsfqvpgsqg|phdabnjdgf|cgpddfdsvm|lrgdversqc|xdqfbdpcmx|mybvirnicf|fnmqudtjud|nvrqlrhgfx|dlxuhmwhqw|ivnvnnwwrr|qhexnienoa|xruvubmbll|tbcvvmyayr|omvvhspkja|gvtoyhells|wepknrkirs|tiuowenuix|yddslqnwxu|nvknwgnnar|ikxidbswff|aegcdpvwsm|bcpjcnjggt|fhietucpbd|buyhoamsds|eccsjgaatf|mxlgwfuaru|gfiewmswxm|awiiwejiqe|mersknkrcx|dtdpmdebes|ihwfyhoncn|gaatuovobu|xdbgpaopxu|ahoybbfivt|itpdyrqtny|lfuytlpxef|wwlllaetiq|lvuyexitpu|fuxovadtog|qtsqokhqul|mowlfmhqqr|eflxxpyoch|sdmoqvgvdk|uvyjknajsi|wqhwakjbxq|bqxgwdcffj|wvwshhjnho|legukwvsob|acbjtgubvy|pggmujexmn|uloalbeyko|kulyobpixh|hanmbcjfam|xwottiyehy|dkppvgieid|eqawetuddx|iuwyflqbve|kbuxirxoga|xblhlkugon|utqggdcesd|hgakyyhysh|nuneaaasko'.split('|'),0,{}))
+});
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-packer-5.html b/mozilla/testing/performance/talos/page_load_test/jss/real-packer-5.html
new file mode 100644
index 00000000000..f9444598b9d
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-packer-5.html
@@ -0,0 +1,33 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Unpack', onlyNum = 16;
+function thisTest() {
+
+startTest("real-packer");
+
+test("Unpack", 1, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="O";0 1="5";0 1="2";0 1="4";0 1="J";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="u";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="t";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="P";',52,52,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|wrijmpchex|lccbddnnxf|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|vmkvdsnxsa|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|hgakyyhysh|iereeyrdnh'.split('|'),0,{}))
+});
+
+test("Unpack", 2, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('1 0="1C";1 0="5";1 0="2";1 0="4";1 0="1v";1 0="6";1 0="7";1 0="8";1 0="3";1 0="a";1 0="b";1 0="c";1 0="10";1 0="d";1 0="f";1 0="g";1 0="h";1 0="i";1 0="j";1 0="k";1 0="9";1 0="m";1 0="n";1 0="o";1 0="p";1 0="q";1 0="r";1 0="s";1 0="Z";1 0="e";1 0="v";1 0="w";1 0="x";1 0="y";1 0="z";1 0="A";1 0="B";1 0="C";1 0="D";1 0="E";1 0="F";1 0="G";1 0="H";1 0="I";1 0="l";1 0="K";1 0="L";1 0="M";1 0="N";1 0="O";1 0="P";1 0="Q";1 0="R";1 0="S";1 0="T";1 0="U";1 0="V";1 0="W";1 0="X";1 0="Y";1 0="u";1 0="t";1 0="11";1 0="12";1 0="13";1 0="14";1 0="15";1 0="16";1 0="17";1 0="18";1 0="19";1 0="1a";1 0="1b";1 0="1c";1 0="1d";1 0="1e";1 0="1f";1 0="1g";1 0="1h";1 0="1i";1 0="1j";1 0="1k";1 0="1l";1 0="1m";1 0="1n";1 0="1o";1 0="1p";1 0="1q";1 0="1r";1 0="1s";1 0="1t";1 0="1u";1 0="J";1 0="1w";1 0="1x";1 0="1y";1 0="1z";1 0="1A";1 0="1B";1 0="1D";',62,102,'aaa|var|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|bcvtqsyrbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|wrijmpchex|lccbddnnxf|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|vmkvdsnxsa|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|hgakyyhysh|rsbgawetse'.split('|'),0,{}))
+});
+
+test("Unpack", 4, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="3e";0 1="5";0 1="2";0 1="4";0 1="33";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="22";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="21";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="O";0 1="P";0 1="Q";0 1="R";0 1="S";0 1="T";0 1="U";0 1="V";0 1="W";0 1="X";0 1="Y";0 1="10";0 1="t";0 1="11";0 1="12";0 1="13";0 1="14";0 1="15";0 1="16";0 1="17";0 1="18";0 1="19";0 1="1a";0 1="1b";0 1="1c";0 1="1d";0 1="1e";0 1="1f";0 1="1g";0 1="1h";0 1="1i";0 1="1j";0 1="1k";0 1="1l";0 1="1m";0 1="1n";0 1="1o";0 1="1p";0 1="1q";0 1="1r";0 1="1s";0 1="1t";0 1="1u";0 1="J";0 1="1w";0 1="1x";0 1="1y";0 1="1z";0 1="1A";0 1="1B";0 1="1C";0 1="1D";0 1="1E";0 1="1F";0 1="1G";0 1="1H";0 1="1I";0 1="1J";0 1="1K";0 1="1L";0 1="1M";0 1="1N";0 1="1O";0 1="1P";0 1="1Q";0 1="1R";0 1="1S";0 1="1T";0 1="1U";0 1="1V";0 1="1W";0 1="1X";0 1="1Y";0 1="1Z";0 1="20";0 1="Z";0 1="u";0 1="23";0 1="24";0 1="25";0 1="26";0 1="27";0 1="28";0 1="29";0 1="2a";0 1="2b";0 1="2c";0 1="2d";0 1="2e";0 1="2f";0 1="2g";0 1="2h";0 1="2i";0 1="2j";0 1="2k";0 1="2l";0 1="2m";0 1="2n";0 1="2o";0 1="2p";0 1="2q";0 1="2r";0 1="2s";0 1="2t";0 1="2u";0 1="2v";0 1="2w";0 1="2x";0 1="2y";0 1="2z";0 1="2A";0 1="2B";0 1="2C";0 1="2D";0 1="2E";0 1="2F";0 1="2G";0 1="2H";0 1="2I";0 1="2J";0 1="2K";0 1="2L";0 1="2M";0 1="2N";0 1="2O";0 1="2P";0 1="2Q";0 1="2R";0 1="2S";0 1="2T";0 1="2U";0 1="2V";0 1="2W";0 1="2X";0 1="2Y";0 1="2Z";0 1="30";0 1="31";0 1="32";0 1="1v";0 1="34";0 1="35";0 1="36";0 1="37";0 1="38";0 1="39";0 1="3a";0 1="3b";0 1="3c";0 1="3d";0 1="3f";',62,202,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|klucopuyfg|bcvtqsyrbw|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|wrijmpchex|lccbddnnxf|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|vmkvdsnxsa|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|hgakyyhysh|prrrrbwosb'.split('|'),0,{}))
+});
+
+test("Unpack", 8, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('0 1="5E";0 1="5";0 1="2";0 1="4";0 1="45";0 1="6";0 1="7";0 1="8";0 1="3";0 1="a";0 1="b";0 1="c";0 1="33";0 1="d";0 1="f";0 1="g";0 1="h";0 1="i";0 1="j";0 1="k";0 1="9";0 1="m";0 1="n";0 1="o";0 1="p";0 1="q";0 1="r";0 1="s";0 1="22";0 1="e";0 1="v";0 1="w";0 1="x";0 1="y";0 1="z";0 1="A";0 1="B";0 1="C";0 1="D";0 1="E";0 1="F";0 1="G";0 1="H";0 1="I";0 1="l";0 1="K";0 1="L";0 1="M";0 1="N";0 1="O";0 1="P";0 1="Q";0 1="R";0 1="S";0 1="T";0 1="U";0 1="V";0 1="W";0 1="X";0 1="Y";0 1="21";0 1="t";0 1="11";0 1="12";0 1="13";0 1="14";0 1="15";0 1="16";0 1="17";0 1="18";0 1="19";0 1="1a";0 1="1b";0 1="1c";0 1="1d";0 1="1e";0 1="1f";0 1="1g";0 1="1h";0 1="1i";0 1="1j";0 1="1k";0 1="1l";0 1="1m";0 1="1n";0 1="1o";0 1="1p";0 1="1q";0 1="1r";0 1="1s";0 1="1t";0 1="1u";0 1="J";0 1="1w";0 1="1x";0 1="1y";0 1="1z";0 1="1A";0 1="1B";0 1="1C";0 1="1D";0 1="1E";0 1="1F";0 1="1G";0 1="1H";0 1="1I";0 1="1J";0 1="1K";0 1="1L";0 1="1M";0 1="1N";0 1="1O";0 1="1P";0 1="1Q";0 1="1R";0 1="1S";0 1="1T";0 1="1U";0 1="1V";0 1="1W";0 1="1X";0 1="1Y";0 1="1Z";0 1="20";0 1="10";0 1="u";0 1="23";0 1="24";0 1="25";0 1="26";0 1="27";0 1="28";0 1="29";0 1="2a";0 1="2b";0 1="2c";0 1="2d";0 1="2e";0 1="2f";0 1="2g";0 1="2h";0 1="2i";0 1="2j";0 1="2k";0 1="2l";0 1="2m";0 1="2n";0 1="2o";0 1="2p";0 1="2q";0 1="2r";0 1="2s";0 1="2t";0 1="2u";0 1="2v";0 1="2w";0 1="2x";0 1="2y";0 1="2z";0 1="2A";0 1="2B";0 1="2C";0 1="2D";0 1="2E";0 1="2F";0 1="2G";0 1="2H";0 1="2I";0 1="2J";0 1="2K";0 1="2L";0 1="2M";0 1="2N";0 1="2O";0 1="2P";0 1="2Q";0 1="2R";0 1="2S";0 1="2T";0 1="2U";0 1="2V";0 1="2W";0 1="2X";0 1="2Y";0 1="2Z";0 1="30";0 1="31";0 1="32";0 1="1v";0 1="34";0 1="35";0 1="36";0 1="37";0 1="38";0 1="39";0 1="3a";0 1="3b";0 1="3c";0 1="3d";0 1="3e";0 1="3f";0 1="3g";0 1="3h";0 1="3i";0 1="3j";0 1="3k";0 1="3l";0 1="3m";0 1="3n";0 1="3o";0 1="3p";0 1="3q";0 1="3r";0 1="3s";0 1="3t";0 1="3u";0 1="3v";0 1="3w";0 1="3x";0 1="3y";0 1="3z";0 1="3A";0 1="3B";0 1="3C";0 1="3D";0 1="3E";0 1="3F";0 1="3G";0 1="3H";0 1="3I";0 1="3J";0 1="3K";0 1="3L";0 1="3M";0 1="3N";0 1="3O";0 1="3P";0 1="3Q";0 1="3R";0 1="3S";0 1="3T";0 1="3U";0 1="3V";0 1="3W";0 1="3X";0 1="3Y";0 1="3Z";0 1="40";0 1="41";0 1="42";0 1="43";0 1="44";0 1="Z";0 1="46";0 1="47";0 1="48";0 1="49";0 1="4a";0 1="4b";0 1="4c";0 1="4d";0 1="4e";0 1="4f";0 1="4g";0 1="4h";0 1="4i";0 1="4j";0 1="4k";0 1="4l";0 1="4m";0 1="4n";0 1="4o";0 1="4p";0 1="4q";0 1="4r";0 1="4s";0 1="4t";0 1="4u";0 1="4v";0 1="4w";0 1="4x";0 1="4y";0 1="4z";0 1="4A";0 1="4B";0 1="4C";0 1="4D";0 1="4E";0 1="4F";0 1="4G";0 1="4H";0 1="4I";0 1="4J";0 1="4K";0 1="4L";0 1="4M";0 1="4N";0 1="4O";0 1="4P";0 1="4Q";0 1="4R";0 1="4S";0 1="4T";0 1="4U";0 1="4V";0 1="4W";0 1="4X";0 1="4Y";0 1="4Z";0 1="50";0 1="51";0 1="52";0 1="53";0 1="54";0 1="55";0 1="56";0 1="57";0 1="58";0 1="59";0 1="5a";0 1="5b";0 1="5c";0 1="5d";0 1="5e";0 1="5f";0 1="5g";0 1="5h";0 1="5i";0 1="5j";0 1="5k";0 1="5l";0 1="5m";0 1="5n";0 1="5o";0 1="5p";0 1="5q";0 1="5r";0 1="5s";0 1="5t";0 1="5u";0 1="5v";0 1="5w";0 1="5x";0 1="5y";0 1="5z";0 1="5A";0 1="5B";0 1="5C";0 1="5D";0 1="5F";',62,352,'var|aaa|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|kgrufshhbi|klucopuyfg|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|bcvtqsyrbw|wrijmpchex|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|lccbddnnxf|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|prrrrbwosb|eixeiqnpio|klwbiuhskx|yommhlpsuv|lwswqksvjf|gyrwjmamam|qqetupasqh|gwqvowymto|wybagnxuqd|djsqhkplsc|hlqrgvlpxs|qifaiqysrk|fyehbjrvni|pdjgenegvl|kjitkvolqr|ferdukxfks|rpiewigpby|akefenlgif|klbmmuwpyd|jnyltfmttp|lujysqvawj|hhvjmofslr|wdaatluhox|fqhbhwqbmr|ggurrkfxov|wjffwansnv|esjiemwyad|tqgmsangoe|rlpulmorwi|nnxcuhnckd|ctsembjxcf|aangwfpqys|xmngfoerny|jrpbnulpox|dpsqoauwnm|rauugjkijg|ollwsllkqs|kvnikdxeph|cuwllwndam|bkrijtslix|wuwjssnhjt|gmcraaparp|fjhoonafof|eufttbynsp|axfbvrfddk|dkdfxxqbxf|fqwbljbgmh|jqwamoqnrh|mefhlhkigy|yooqjnroiu|iaooxoaipe|lusglgaysi|oufkboxjnf|vmkvdsnxsa|breagupopf|usbedqodtq|uvqdqdkyse|dfouomesrt|khvcwpbwgg|wkldupuafq|jcbdxmsubk|nrgojtequh|vkfvrxtklp|gkpjfvsuwd|ktyflbwbmh|rfecruligy|ufhrnyakqf|hqyqhupmol|xlokvsfkah|soqbgydpxm|xtonuesqvg|hlwyjdmkfd|vwsifvbbff|hqruytxtlv|jfykspsvrm|tbauhtygkk|fquhewgbdb|oyybyrelad|qtccfyrcgs|cbrwxeowqq|wfoqdpybil|ikanvyvjmm|tqeqmaufol|wvujwtcnah|olapskhbpj|stfovrpsfe|blvrbrupjk|ofacjnjqbo|tclgntfagf|xbseencenh|kthsdhprsq|tfpajwfgjs|wbhklegkwy|nrqsshpuwl|jtkpbwyruo|xbvjyeptje|cbhhlmgnhc|ueuhgmnbpe|tjqrxnykrt|hdnxaktmib|ulgxqqxuhq|djlwgjoncp|bewccrvvwk|gwugxhfash|oonbpqpouj|hdilbbrgeo|bsqnetaheb|gaoyyttudo|aapupxyxoa|fpamqvwvgv|rvdmbvbvde|mtkxdyajpy|xoajfcbxmb|qflgiwqgfb|qcjeevkpuv|iontkfrobc|ncpwklekjw|pqhytepvxr|iyxkvcncud|tnqgxplmdb|agwbspfopi|wckdutjygo|priunngtip|qpiprdyjnw|ksjgdjlgdw|fefxhsdnut|ahfubmxgps|vvnekomybk|kdvqllyqpu|hbfsnuikpl|ahkebjwssv|qyuitbvfis|uqbaxujbiq|vpxrirabal|ntdequjjwj|wqstmjuygy|iocgjwalgg|ojvevginrc|iafnlktqal|mjpynjnydj|fccequfmhy|onymdbdxuf|bxpwdrxnis|raivofactb|uqampwtwob|haicwqbpqf|rwqpkdcbsj|hnpjspdpjj|maedfwfiow|smqigfjfxi|hgakyyhysh|pqgkcjydcm'.split('|'),0,{}))
+});
+
+test("Unpack", 16, function(){
+eval(function(p,a,c,k,e,r){e=function(c){return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('1 0="c6";1 0="5";1 0="2";1 0="4";1 0="8d";1 0="6";1 0="7";1 0="8";1 0="3";1 0="a";1 0="b";1 0="c";1 0="69";1 0="d";1 0="f";1 0="g";1 0="h";1 0="i";1 0="j";1 0="k";1 0="9";1 0="m";1 0="n";1 0="o";1 0="p";1 0="q";1 0="r";1 0="s";1 0="46";1 0="e";1 0="v";1 0="w";1 0="x";1 0="y";1 0="z";1 0="A";1 0="B";1 0="C";1 0="D";1 0="E";1 0="F";1 0="G";1 0="H";1 0="I";1 0="l";1 0="K";1 0="L";1 0="M";1 0="N";1 0="O";1 0="P";1 0="Q";1 0="R";1 0="S";1 0="T";1 0="U";1 0="V";1 0="W";1 0="X";1 0="Y";1 0="45";1 0="t";1 0="11";1 0="12";1 0="13";1 0="14";1 0="15";1 0="16";1 0="17";1 0="18";1 0="19";1 0="1a";1 0="1b";1 0="1c";1 0="1d";1 0="1e";1 0="1f";1 0="1g";1 0="1h";1 0="1i";1 0="1j";1 0="1k";1 0="1l";1 0="1m";1 0="1n";1 0="1o";1 0="1p";1 0="1q";1 0="1r";1 0="1s";1 0="1t";1 0="1u";1 0="J";1 0="1w";1 0="1x";1 0="1y";1 0="1z";1 0="1A";1 0="1B";1 0="1C";1 0="1D";1 0="1E";1 0="1F";1 0="1G";1 0="1H";1 0="1I";1 0="1J";1 0="1K";1 0="1L";1 0="1M";1 0="1N";1 0="1O";1 0="1P";1 0="1Q";1 0="1R";1 0="1S";1 0="1T";1 0="1U";1 0="1V";1 0="1W";1 0="1X";1 0="1Y";1 0="1Z";1 0="20";1 0="22";1 0="u";1 0="23";1 0="24";1 0="25";1 0="26";1 0="27";1 0="28";1 0="29";1 0="2a";1 0="2b";1 0="2c";1 0="2d";1 0="2e";1 0="2f";1 0="2g";1 0="2h";1 0="2i";1 0="2j";1 0="2k";1 0="2l";1 0="2m";1 0="2n";1 0="2o";1 0="2p";1 0="2q";1 0="2r";1 0="2s";1 0="2t";1 0="2u";1 0="2v";1 0="2w";1 0="2x";1 0="2y";1 0="2z";1 0="2A";1 0="2B";1 0="2C";1 0="2D";1 0="2E";1 0="2F";1 0="2G";1 0="2H";1 0="2I";1 0="2J";1 0="2K";1 0="2L";1 0="2M";1 0="2N";1 0="2O";1 0="2P";1 0="2Q";1 0="2R";1 0="2S";1 0="2T";1 0="2U";1 0="2V";1 0="2W";1 0="2X";1 0="2Y";1 0="2Z";1 0="30";1 0="31";1 0="32";1 0="1v";1 0="34";1 0="35";1 0="36";1 0="37";1 0="38";1 0="39";1 0="3a";1 0="3b";1 0="3c";1 0="3d";1 0="3e";1 0="3f";1 0="3g";1 0="3h";1 0="3i";1 0="3j";1 0="3k";1 0="3l";1 0="3m";1 0="3n";1 0="3o";1 0="3p";1 0="3q";1 0="3r";1 0="3s";1 0="3t";1 0="3u";1 0="3v";1 0="3w";1 0="3x";1 0="3y";1 0="3z";1 0="3A";1 0="3B";1 0="3C";1 0="3D";1 0="3E";1 0="3F";1 0="3G";1 0="3H";1 0="3I";1 0="3J";1 0="3K";1 0="3L";1 0="3M";1 0="3N";1 0="3O";1 0="3P";1 0="3Q";1 0="3R";1 0="3S";1 0="3T";1 0="3U";1 0="3V";1 0="3W";1 0="3X";1 0="3Y";1 0="3Z";1 0="40";1 0="41";1 0="42";1 0="43";1 0="44";1 0="21";1 0="Z";1 0="47";1 0="48";1 0="49";1 0="4a";1 0="4b";1 0="4c";1 0="4d";1 0="4e";1 0="4f";1 0="4g";1 0="4h";1 0="4i";1 0="4j";1 0="4k";1 0="4l";1 0="4m";1 0="4n";1 0="4o";1 0="4p";1 0="4q";1 0="4r";1 0="4s";1 0="4t";1 0="4u";1 0="4v";1 0="4w";1 0="4x";1 0="4y";1 0="4z";1 0="4A";1 0="4B";1 0="4C";1 0="4D";1 0="4E";1 0="4F";1 0="4G";1 0="4H";1 0="4I";1 0="4J";1 0="4K";1 0="4L";1 0="4M";1 0="4N";1 0="4O";1 0="4P";1 0="4Q";1 0="4R";1 0="4S";1 0="4T";1 0="4U";1 0="4V";1 0="4W";1 0="4X";1 0="4Y";1 0="4Z";1 0="50";1 0="51";1 0="52";1 0="53";1 0="54";1 0="55";1 0="56";1 0="57";1 0="58";1 0="59";1 0="5a";1 0="5b";1 0="5c";1 0="5d";1 0="5e";1 0="5f";1 0="5g";1 0="5h";1 0="5i";1 0="5j";1 0="5k";1 0="5l";1 0="5m";1 0="5n";1 0="5o";1 0="5p";1 0="5q";1 0="5r";1 0="5s";1 0="5t";1 0="5u";1 0="5v";1 0="5w";1 0="5x";1 0="5y";1 0="5z";1 0="5A";1 0="5B";1 0="5C";1 0="5D";1 0="5E";1 0="5F";1 0="5G";1 0="5H";1 0="5I";1 0="5J";1 0="5K";1 0="5L";1 0="5M";1 0="5N";1 0="5O";1 0="5P";1 0="5Q";1 0="5R";1 0="5S";1 0="5T";1 0="5U";1 0="5V";1 0="5W";1 0="5X";1 0="5Y";1 0="5Z";1 0="60";1 0="61";1 0="62";1 0="63";1 0="64";1 0="65";1 0="66";1 0="67";1 0="68";1 0="33";1 0="6a";1 0="6b";1 0="6c";1 0="6d";1 0="6e";1 0="6f";1 0="6g";1 0="6h";1 0="6i";1 0="6j";1 0="6k";1 0="6l";1 0="6m";1 0="6n";1 0="6o";1 0="6p";1 0="6q";1 0="6r";1 0="6s";1 0="6t";1 0="6u";1 0="6v";1 0="6w";1 0="6x";1 0="6y";1 0="6z";1 0="6A";1 0="6B";1 0="6C";1 0="6D";1 0="6E";1 0="6F";1 0="6G";1 0="6H";1 0="6I";1 0="6J";1 0="6K";1 0="6L";1 0="6M";1 0="6N";1 0="6O";1 0="6P";1 0="6Q";1 0="6R";1 0="6S";1 0="6T";1 0="6U";1 0="6V";1 0="6W";1 0="6X";1 0="6Y";1 0="6Z";1 0="70";1 0="71";1 0="72";1 0="73";1 0="74";1 0="75";1 0="76";1 0="77";1 0="78";1 0="79";1 0="7a";1 0="7b";1 0="7c";1 0="7d";1 0="7e";1 0="7f";1 0="7g";1 0="7h";1 0="7i";1 0="7j";1 0="7k";1 0="7l";1 0="7m";1 0="7n";1 0="7o";1 0="7p";1 0="7q";1 0="7r";1 0="7s";1 0="7t";1 0="7u";1 0="7v";1 0="7w";1 0="7x";1 0="7y";1 0="7z";1 0="7A";1 0="7B";1 0="7C";1 0="7D";1 0="7E";1 0="7F";1 0="7G";1 0="7H";1 0="7I";1 0="7J";1 0="7K";1 0="7L";1 0="7M";1 0="7N";1 0="7O";1 0="7P";1 0="7Q";1 0="7R";1 0="7S";1 0="7T";1 0="7U";1 0="7V";1 0="7W";1 0="7X";1 0="7Y";1 0="7Z";1 0="80";1 0="81";1 0="82";1 0="83";1 0="84";1 0="85";1 0="86";1 0="87";1 0="88";1 0="89";1 0="8a";1 0="8b";1 0="8c";1 0="10";1 0="8e";1 0="8f";1 0="8g";1 0="8h";1 0="8i";1 0="8j";1 0="8k";1 0="8l";1 0="8m";1 0="8n";1 0="8o";1 0="8p";1 0="8q";1 0="8r";1 0="8s";1 0="8t";1 0="8u";1 0="8v";1 0="8w";1 0="8x";1 0="8y";1 0="8z";1 0="8A";1 0="8B";1 0="8C";1 0="8D";1 0="8E";1 0="8F";1 0="8G";1 0="8H";1 0="8I";1 0="8J";1 0="8K";1 0="8L";1 0="8M";1 0="8N";1 0="8O";1 0="8P";1 0="8Q";1 0="8R";1 0="8S";1 0="8T";1 0="8U";1 0="8V";1 0="8W";1 0="8X";1 0="8Y";1 0="8Z";1 0="90";1 0="91";1 0="92";1 0="93";1 0="94";1 0="95";1 0="96";1 0="97";1 0="98";1 0="99";1 0="9a";1 0="9b";1 0="9c";1 0="9d";1 0="9e";1 0="9f";1 0="9g";1 0="9h";1 0="9i";1 0="9j";1 0="9k";1 0="9l";1 0="9m";1 0="9n";1 0="9o";1 0="9p";1 0="9q";1 0="9r";1 0="9s";1 0="9t";1 0="9u";1 0="9v";1 0="9w";1 0="9x";1 0="9y";1 0="9z";1 0="9A";1 0="9B";1 0="9C";1 0="9D";1 0="9E";1 0="9F";1 0="9G";1 0="9H";1 0="9I";1 0="9J";1 0="9K";1 0="9L";1 0="9M";1 0="9N";1 0="9O";1 0="9P";1 0="9Q";1 0="9R";1 0="9S";1 0="9T";1 0="9U";1 0="9V";1 0="9W";1 0="9X";1 0="9Y";1 0="9Z";1 0="a0";1 0="a1";1 0="a2";1 0="a3";1 0="a4";1 0="a5";1 0="a6";1 0="a7";1 0="a8";1 0="a9";1 0="aa";1 0="ab";1 0="ac";1 0="ad";1 0="ae";1 0="af";1 0="ag";1 0="ah";1 0="ai";1 0="aj";1 0="ak";1 0="al";1 0="am";1 0="an";1 0="ao";1 0="ap";1 0="aq";1 0="ar";1 0="as";1 0="at";1 0="au";1 0="av";1 0="aw";1 0="ax";1 0="ay";1 0="az";1 0="aA";1 0="aB";1 0="aC";1 0="aD";1 0="aE";1 0="aF";1 0="aG";1 0="aH";1 0="aI";1 0="aJ";1 0="aK";1 0="aL";1 0="aM";1 0="aN";1 0="aO";1 0="aP";1 0="aQ";1 0="aR";1 0="aS";1 0="aT";1 0="aU";1 0="aV";1 0="aW";1 0="aX";1 0="aY";1 0="aZ";1 0="b0";1 0="b1";1 0="b2";1 0="b3";1 0="b4";1 0="b5";1 0="b6";1 0="b7";1 0="b8";1 0="b9";1 0="ba";1 0="bb";1 0="bc";1 0="bd";1 0="be";1 0="bf";1 0="bg";1 0="bh";1 0="bi";1 0="bj";1 0="bk";1 0="bl";1 0="bm";1 0="bn";1 0="bo";1 0="bp";1 0="bq";1 0="br";1 0="bs";1 0="bt";1 0="bu";1 0="bv";1 0="bw";1 0="bx";1 0="by";1 0="bz";1 0="bA";1 0="bB";1 0="bC";1 0="bD";1 0="bE";1 0="bF";1 0="bG";1 0="bH";1 0="bI";1 0="bJ";1 0="bK";1 0="bL";1 0="bM";1 0="bN";1 0="bO";1 0="bP";1 0="bQ";1 0="bR";1 0="bS";1 0="bT";1 0="bU";1 0="bV";1 0="bW";1 0="bX";1 0="bY";1 0="bZ";1 0="c0";1 0="c1";1 0="c2";1 0="c3";1 0="c4";1 0="c5";1 0="c7";',62,752,'aaa|var|wodtobcujl|mrtntqwevl|lhjxmmfcbl|hdjsgeqjul|hqsqxcxxbf|mlgwjlccsy|rbrxhwlwor|ysjkisnldq|wswludndbk|agpffqgamm|eadnrhfgyk|qhfrrhdnxm|xlhptpyaop|lnvvqnavgf|ptqfyicasl|mxvxqkwhxq|mcwmappbmg|forityxoxd|oqgvepkxbx|brilkslign|xesbftgisq|bwfkvwuahc|sxtvhcsrsy|ahhnjuomqn|bhsyjpokcj|equptojrwn|mbdjispmuq|nwjtgqnutx|uialotxkbw|lfjvfpgrrg|pqqptnfenl|fjycbfoyfm|kgoonjpmto|ckusibqcfa|jxrnlpaauk|oealnphvqs|fjebxatwdw|qifrurrawe|rwveahxhku|wflavcemrx|qvbnheaovr|hcxlmrhxwk|jaxubptioq|hyvsojhqcr|niheibroou|mqyuiatxoc|kywmgogrlf|qcfbibsfta|iereeyrdnh|qwvxgytlxp|gnfkisntof|vpxtgdiedn|djsivelmsh|ilaaukgseo|fcnohtangn|yfrqdhkwnf|emxquatwss|enuphggvko|cpsoesdqum|breagupopf|werjimrcgo|ivadepykhq|mpchsamiof|gnhenuqoli|dnydjxtyci|qdseivvsbn|cbsvncuype|sadbifbaku|hmnnytuliq|lkkyrxmmno|fquobrmdcu|kjprxpfnlq|tkmtevxnas|dqawcfjbom|kwmffggxov|aestcexvnm|feiogdrifw|qcathigbxy|jppnouvffe|yyvoojmofb|mwbakcfyfv|pebqxyoryc|jmjinguxio|uowxxmbwad|jsnqvkapeh|kjqbcwnyms|kvtvosxpgg|ixqvbsgtlo|qhhxyymigo|nivaxuneis|gevqmnmxbi|kmdarjeifo|ylccqnpjxo|dmqncnekcf|juvnegvmyk|rtqjctlmqa|wuvaasjjhd|qngqgscfoy|rsbgawetse|wqiqbenavr|ouvhdykhoo|mpafroymyk|ykulgokjim|cdvlcruulr|agcieewvhg|npdkeecqdi|restfvsnsk|yccuuaxlax|lwbqpxkplv|hjukhfshia|fxykjevyag|ccqqvgdjum|eirskiljaf|fhgmrtpsvg|glokkalyem|efggwfyxkc|hihljeyctr|jsqbjwaags|jbrintkdey|qjqwgssmqw|ynurdafqni|bsgbcxgbil|hlvlpyubqc|kgrufshhbi|klucopuyfg|ygeexsuogp|frqhajmepv|omyncegohl|ejcejoqbxk|jaderqfxkq|ryrfydehcm|miwuxniyfl|delibbokxo|egscnrmabk|okkjcwvmds|dqmeqpsdhf|acqyyebvbv|eguitplgdh|ixmlqaqpyk|iufifstrca|okbdwvpxka|vxaikuxpiv|ihlutminfc|jyphnmlaji|swlhbjomql|aqiakjvtoa|gpuyrtrsgh|wfehvxylhx|jdqtweslog|petedhdyog|nytiiwnwlt|pdadnwcvmb|qssnfopulf|pycsysccla|uytensaxur|vahiiheccc|fpxrufuyrf|iaxivnjltx|deesevaykc|ikqdfcpivp|updngesewi|vqspelttoc|cfqiwlkufi|mbfcvsihfk|eynkksokae|neggmfkqgq|tnmibppqdb|nfygatdbnp|xdpdoasipq|kkbbrqihsl|fhyxxvmbag|arxjsufuva|penkntkpqp|ohltuxgnpo|bvqbxxfogn|lymuuxesoe|ytyuwumrhd|vkkapcaian|wtdbpongyq|mmxklvsbaf|okpopwabha|ntkongjhjk|frnghtmjsq|rmfjaxnxdr|voktbtpuvr|eamllbonxl|wnciesmtwo|vsxvrorijn|enrjpmpkdn|wueeaketep|xfjcolhpxj|vurvfqwnql|ckqkrheotg|wchgsshrme|sstftspruo|iibmbnaxrm|jtdecrajfs|ytkrhvqchs|prrrrbwosb|eixeiqnpio|klwbiuhskx|yommhlpsuv|lwswqksvjf|gyrwjmamam|qqetupasqh|gwqvowymto|wybagnxuqd|djsqhkplsc|hlqrgvlpxs|qifaiqysrk|fyehbjrvni|pdjgenegvl|kjitkvolqr|ferdukxfks|rpiewigpby|akefenlgif|klbmmuwpyd|jnyltfmttp|lujysqvawj|hhvjmofslr|wdaatluhox|fqhbhwqbmr|ggurrkfxov|wjffwansnv|esjiemwyad|tqgmsangoe|rlpulmorwi|nnxcuhnckd|ctsembjxcf|aangwfpqys|xmngfoerny|jrpbnulpox|dpsqoauwnm|rauugjkijg|ollwsllkqs|kvnikdxeph|cuwllwndam|bkrijtslix|wuwjssnhjt|gmcraaparp|fjhoonafof|eufttbynsp|axfbvrfddk|dkdfxxqbxf|fqwbljbgmh|jqwamoqnrh|mefhlhkigy|yooqjnroiu|iaooxoaipe|lusglgaysi|oufkboxjnf|bcvtqsyrbw|wrijmpchex|usbedqodtq|uvqdqdkyse|dfouomesrt|khvcwpbwgg|wkldupuafq|jcbdxmsubk|nrgojtequh|vkfvrxtklp|gkpjfvsuwd|ktyflbwbmh|rfecruligy|ufhrnyakqf|hqyqhupmol|xlokvsfkah|soqbgydpxm|xtonuesqvg|hlwyjdmkfd|vwsifvbbff|hqruytxtlv|jfykspsvrm|tbauhtygkk|fquhewgbdb|oyybyrelad|qtccfyrcgs|cbrwxeowqq|wfoqdpybil|ikanvyvjmm|tqeqmaufol|wvujwtcnah|olapskhbpj|stfovrpsfe|blvrbrupjk|ofacjnjqbo|tclgntfagf|xbseencenh|kthsdhprsq|tfpajwfgjs|wbhklegkwy|nrqsshpuwl|jtkpbwyruo|xbvjyeptje|cbhhlmgnhc|ueuhgmnbpe|tjqrxnykrt|hdnxaktmib|ulgxqqxuhq|djlwgjoncp|bewccrvvwk|gwugxhfash|oonbpqpouj|hdilbbrgeo|bsqnetaheb|gaoyyttudo|aapupxyxoa|fpamqvwvgv|rvdmbvbvde|mtkxdyajpy|xoajfcbxmb|qflgiwqgfb|qcjeevkpuv|iontkfrobc|ncpwklekjw|pqhytepvxr|iyxkvcncud|tnqgxplmdb|agwbspfopi|wckdutjygo|priunngtip|qpiprdyjnw|ksjgdjlgdw|fefxhsdnut|ahfubmxgps|vvnekomybk|kdvqllyqpu|hbfsnuikpl|ahkebjwssv|qyuitbvfis|uqbaxujbiq|vpxrirabal|ntdequjjwj|wqstmjuygy|iocgjwalgg|ojvevginrc|iafnlktqal|mjpynjnydj|fccequfmhy|onymdbdxuf|bxpwdrxnis|raivofactb|uqampwtwob|haicwqbpqf|rwqpkdcbsj|hnpjspdpjj|maedfwfiow|smqigfjfxi|pqgkcjydcm|tujevpuuli|sujvoiwohs|hqfwgohvwq|auwjikxtha|rrkccxyxky|dvvgdwkenb|ldnsbuiaup|ineipkhohb|rddfnjadgt|makluthjim|ymgvbdimnx|djqyumugkn|wplsmntryf|kjukmfwwji|fnxbopikau|pfboshiqbg|yluoljqghf|taptwfnpnw|gnqnsuttjy|jlfscwefty|heucdpmecn|ihvtsaybqn|loufssrhmd|xxpvtbnrxl|mslcvkyptu|scfksirfus|coasnpqbal|frpifjsmhm|oyrsxupppa|gtmxstmxgw|lccbddnnxf|nsvtputckc|ipqfitwaug|oesowuyhec|mpvjqrovvj|xxnrgytkal|mgjxiypeqt|pqcdouxabn|dtneacihbl|cjkkvfskdf|gqqkfmujtg|idasgwdylf|mtmbwnwhrf|febkulwcwd|udgappxnfc|oeounuhwho|sjpqtqrlpv|pagnwrxrps|qqrwiuthuk|ijmjsqqctu|sqbctxhqne|mxvdkrcswp|wcqorskhol|fwgegcvyec|iorwpkftgx|rjnrhluhci|twyktwpkkk|jcvnnqxela|npmnauyenx|fmjifmxmga|nagwfhcnpq|bsicplsatb|atphmlaoti|owoagpdhvv|okeajpbnml|ukugrdjpet|rlgpjsyaje|rcdoecobqx|wikoprekab|hhhjlawjis|eqfgphcyhk|miablyqdsg|uqgjqnclce|ynjeaqhhvj|pcchimuvyc|karmvhawrd|upavyhppju|hxbpptxgir|kcrneyprmt|dneeaxevhr|ptxonkmnvo|tofaghvfya|asxkecbpgq|keofkhhidm|ygfcouswlh|rkpborjnhw|bjvmvvayqv|boqvpyuqyx|jjitbhfabt|rlmqtiyefm|grbkccnwjb|cxilkyoaqe|nytoiomruk|wkhaxwvsig|mkmqouhlux|kxqybgmbvd|gyohmkaghk|nosthntnpc|eecfofhkey|otaftyplld|qwdbbvvpae|dchthgxlkt|kedssfykwf|iefptayfoj|xvflxsflyy|dkfunrmbml|hklmsgmebu|fcirkivtaw|kpkeherygc|tegoqadwhs|ouajtcnaex|fpuxxupevj|suwajflhib|mxpjkxtpiv|wvixbjmqxx|kxskivawug|ogurbgvlxc|mrpvryjxho|qtregjalbx|dpttetgwab|ivrepttkad|xwtekkgmmg|goncgoetoo|xtmebvdmnt|avwxmhxlmt|mblpkonkru|octdffpxvi|cphaimnkem|pgqkixhkrm|neweqlvykv|rwpaxtvvcd|meoeqvikvf|sesidaswum|lnvflqrsut|acxdeigusf|axespcbupb|jnfmaarrwu|vtxrrjbvbi|ahvtdtqgeb|tulgfqygrd|mrjaalwnry|ygrubyjsbe|hppeeiysix|anejrvremq|uimvbkbguk|yvmenqbdyt|pfqofbbexs|nvafvegcmx|ebrcndduai|gyirklbcgq|gurtqinfyx|naxqjcbpaw|drwquymxmo|gkpewoxsxd|unrtnfsamm|lbaaytsmoc|xtbseujdgw|oigdahqrfg|vmkvdsnxsa|udwyblgvvg|wceowsfods|fghfcpkisi|frljvpjaug|akvggmvlir|rerlxfvsjg|vbtderkpoi|xajswoxdfk|kehfcqgiwe|juyadrkyla|olulyxbatd|elotjjgfqn|vxvpaqlxed|qtauqxvyei|fjcnklrisf|snmesqlwhg|qyoukmdqmj|qcadvxkmee|owwpkwwkyh|botpindxwv|kkwjxbmfsc|cwynvaodvp|iftehefeeq|ofgdiwxphw|iwobhhslvy|aqjldssjbw|mmphapfpfw|sugbfunmgr|aikbnbspwv|frhxurmxld|wivoakyeve|esmlvkoeom|qhivtruvyr|swqadbqalh|iryygfbedr|aaoebkeoyr|hkxaucfnnq|gkcuwtucbc|flodjmegvp|lfbvpaolbu|tarrpxddqa|frkhgcfuqv|vjoeaoyeno|krqssjimfr|tsyflxeijs|tylqhkwaas|jtlmqxdnjt|ubqfchijhx|bjeydheeij|tuanpfdwwk|tyqfdrjpdj|hbtcpwygkq|dfcxtkuqaa|xsqfsjafdg|rieypwriub|gbsckpuqut|aacrtfuwpl|kmdejtxjxa|egjlvhukcm|ulnkdmpycn|jqbtoxxcgo|cccmxkqdow|dsnjuekdbs|fbiagfpxfg|lrqhhmonth|oemdeiarih|bfjufckwkw|hofetwrjtg|wjhnenwnxc|mpaexvbqxr|lwpvpafxej|kcmaahkykh|rmpbqaaffn|qljnmfcloc|ippvtsxbod|bdvueubwmi|iedcgpjgpr|dfvhvnwoyy|owrupuccbw|htswogsaag|cxjqvygxlq|pojmgslclk|slrjasubwl|ytxwcophfu|gaappkktuu|xcjheivnkb|yclmegwinr|gmgtibralg|hbbyhdgvgd|iqqxhgljlq|ioafsqlube|hurcahkfvr|sxlnfqfinr|pmmstdviqb|pbdhumkbqm|plbnummold|wsekvwumls|xkrowadmri|wqtpyxskkc|ksqvlhsojv|tshxulebut|ifwwvaksgp|keqjwcoaaf|txxxhoagmd|akrltggutp|bjqbkhubnr|qoqficdvmb|mimaublaih|obeqslvrpo|cxhhqhiyls|grvohirlnp|kehnofmsyg|fwclgrfefr|ytbfwqvtti|jknckpjvhn|okqwbysbow|oyypuobjin|jqkctlxmrw|enpnhvbehu|gkpsfnalwd|bpxtscthrw|sasnrnpwng|lgprxcajmn|ejhmxbuffq|nvuivrutbq|yitiodnnqt|mvkrmomisv|cxehbowcix|gxbkwvufbd|anvnfbhjbg|jbqttgbrbo|jljyujcucf|cjjenppbhq|cddbacgtur|bujctpjkyu|uphxoakjts|rtoqmbvdjy|bkvlprcyoo|jhwduvkgfq|rolmglkbgd|ueuebvnjde|hroisscxdh|vlsomwjfki|dakowybtvo|mpihrdtcvj|noybppfrnu|fqnmvxfoum|axgcleopvd|esuhnaillm|bsohidnmrg|qafwplsulf|ebhxeqarwh|gpcykuiapl|bhlqfuknbi|jelewrejnv|qfmbsuygki|kjkiavpjga|ymnryrmhyd|lqmobpncox|vpwvhjqhoy|lardapowjh|bocsopwnxs|htgstsuqfb|jqpknssjdl|huuosujkbv|pmcqlphghv|xfmfcuefnx|vdyvelvcng|suftgiquvn|yweryjgrwc|wjopiwjtrk|mscpeaqfvq|mlxmvhvkeo|fsghgqkvef|aidtwgbyyu|sjsoiggwya|prldgrxjhi|cqcooipxus|jylrqlbyie|yhatfowfuy|fsfqvpgsqg|phdabnjdgf|cgpddfdsvm|lrgdversqc|xdqfbdpcmx|mybvirnicf|fnmqudtjud|nvrqlrhgfx|dlxuhmwhqw|ivnvnnwwrr|qhexnienoa|xruvubmbll|tbcvvmyayr|omvvhspkja|gvtoyhells|wepknrkirs|tiuowenuix|yddslqnwxu|nvknwgnnar|ikxidbswff|aegcdpvwsm|bcpjcnjggt|fhietucpbd|buyhoamsds|eccsjgaatf|mxlgwfuaru|gfiewmswxm|awiiwejiqe|mersknkrcx|dtdpmdebes|ihwfyhoncn|gaatuovobu|xdbgpaopxu|ahoybbfivt|itpdyrqtny|lfuytlpxef|wwlllaetiq|lvuyexitpu|fuxovadtog|qtsqokhqul|mowlfmhqqr|eflxxpyoch|sdmoqvgvdk|uvyjknajsi|wqhwakjbxq|bqxgwdcffj|wvwshhjnho|legukwvsob|acbjtgubvy|pggmujexmn|uloalbeyko|kulyobpixh|hanmbcjfam|xwottiyehy|dkppvgieid|eqawetuddx|iuwyflqbve|kbuxirxoga|xblhlkugon|utqggdcesd|hgakyyhysh|nuneaaasko'.split('|'),0,{}))
+});
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-1.html
new file mode 100644
index 00000000000..6e76be74ccf
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-1.html
@@ -0,0 +1,48 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Partial Sums', onlyNum = 1024;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function partial(n){
+	var a1 = a2 = a3 = a4 = a5 = a6 = a7 = a8 = a9 = 0.0;
+	var twothirds = 2.0/3.0;
+	var alt = -1.0;
+	var k2 = k3 = sk = ck = 0.0;
+	
+	for (var k = 1; k <= n; k++){
+		k2 = k*k;
+		k3 = k2*k;
+		sk = Math.sin(k);
+		ck = Math.cos(k);
+		alt = -alt;
+		
+		a1 += Math.pow(twothirds,k-1);
+		a2 += Math.pow(k,-0.5);
+		a3 += 1.0/(k*(k+1.0));
+		a4 += 1.0/(k3 * sk*sk);
+		a5 += 1.0/(k3 * ck*ck);
+		a6 += 1.0/k;
+		a7 += 1.0/k2;
+		a8 += alt/k;
+		a9 += alt/(2*k -1);
+	}
+}
+
+startTest("real-partial-sums");
+
+for ( var i = 1024; i <= 8192; i *= 2 ) (function(i){
+	test( "Partial Sums", i, function(){
+		partial(i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-2.html
new file mode 100644
index 00000000000..0f88dd33328
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-2.html
@@ -0,0 +1,48 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Partial Sums', onlyNum = 2048;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function partial(n){
+	var a1 = a2 = a3 = a4 = a5 = a6 = a7 = a8 = a9 = 0.0;
+	var twothirds = 2.0/3.0;
+	var alt = -1.0;
+	var k2 = k3 = sk = ck = 0.0;
+	
+	for (var k = 1; k <= n; k++){
+		k2 = k*k;
+		k3 = k2*k;
+		sk = Math.sin(k);
+		ck = Math.cos(k);
+		alt = -alt;
+		
+		a1 += Math.pow(twothirds,k-1);
+		a2 += Math.pow(k,-0.5);
+		a3 += 1.0/(k*(k+1.0));
+		a4 += 1.0/(k3 * sk*sk);
+		a5 += 1.0/(k3 * ck*ck);
+		a6 += 1.0/k;
+		a7 += 1.0/k2;
+		a8 += alt/k;
+		a9 += alt/(2*k -1);
+	}
+}
+
+startTest("real-partial-sums");
+
+for ( var i = 1024; i <= 8192; i *= 2 ) (function(i){
+	test( "Partial Sums", i, function(){
+		partial(i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-3.html
new file mode 100644
index 00000000000..a9c652add01
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-3.html
@@ -0,0 +1,48 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Partial Sums', onlyNum = 4096;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function partial(n){
+	var a1 = a2 = a3 = a4 = a5 = a6 = a7 = a8 = a9 = 0.0;
+	var twothirds = 2.0/3.0;
+	var alt = -1.0;
+	var k2 = k3 = sk = ck = 0.0;
+	
+	for (var k = 1; k <= n; k++){
+		k2 = k*k;
+		k3 = k2*k;
+		sk = Math.sin(k);
+		ck = Math.cos(k);
+		alt = -alt;
+		
+		a1 += Math.pow(twothirds,k-1);
+		a2 += Math.pow(k,-0.5);
+		a3 += 1.0/(k*(k+1.0));
+		a4 += 1.0/(k3 * sk*sk);
+		a5 += 1.0/(k3 * ck*ck);
+		a6 += 1.0/k;
+		a7 += 1.0/k2;
+		a8 += alt/k;
+		a9 += alt/(2*k -1);
+	}
+}
+
+startTest("real-partial-sums");
+
+for ( var i = 1024; i <= 8192; i *= 2 ) (function(i){
+	test( "Partial Sums", i, function(){
+		partial(i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-4.html
new file mode 100644
index 00000000000..6f3dc77cab4
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-partial-sums-4.html
@@ -0,0 +1,48 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Partial Sums', onlyNum = 8192;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function partial(n){
+	var a1 = a2 = a3 = a4 = a5 = a6 = a7 = a8 = a9 = 0.0;
+	var twothirds = 2.0/3.0;
+	var alt = -1.0;
+	var k2 = k3 = sk = ck = 0.0;
+	
+	for (var k = 1; k <= n; k++){
+		k2 = k*k;
+		k3 = k2*k;
+		sk = Math.sin(k);
+		ck = Math.cos(k);
+		alt = -alt;
+		
+		a1 += Math.pow(twothirds,k-1);
+		a2 += Math.pow(k,-0.5);
+		a3 += 1.0/(k*(k+1.0));
+		a4 += 1.0/(k3 * sk*sk);
+		a5 += 1.0/(k3 * ck*ck);
+		a6 += 1.0/k;
+		a7 += 1.0/k2;
+		a8 += alt/k;
+		a9 += alt/(2*k -1);
+	}
+}
+
+startTest("real-partial-sums");
+
+for ( var i = 1024; i <= 8192; i *= 2 ) (function(i){
+	test( "Partial Sums", i, function(){
+		partial(i);
+	});
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-1.html
new file mode 100644
index 00000000000..e32d875c0e5
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-1.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Ack', onlyNum = 3;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-10.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-10.html
new file mode 100644
index 00000000000..4aaee1460d3
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-10.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Ack', onlyNum = 6;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-11.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-11.html
new file mode 100644
index 00000000000..0618176a3e8
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-11.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Fib', onlyNum = 6;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-12.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-12.html
new file mode 100644
index 00000000000..04485b4e125
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-12.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Tak', onlyNum = 6;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-2.html
new file mode 100644
index 00000000000..3a7b3b69bde
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-2.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Fib', onlyNum = 3;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-3.html
new file mode 100644
index 00000000000..91c8f0e5859
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-3.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Tak', onlyNum = 3;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-4.html
new file mode 100644
index 00000000000..6ee76cea093
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-4.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Ack', onlyNum = 4;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-5.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-5.html
new file mode 100644
index 00000000000..2a550bf1871
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-5.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Fib', onlyNum = 4;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-6.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-6.html
new file mode 100644
index 00000000000..66677a9bd8f
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-6.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Tak', onlyNum = 4;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-7.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-7.html
new file mode 100644
index 00000000000..620a0df4809
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-7.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Ack', onlyNum = 5;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-8.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-8.html
new file mode 100644
index 00000000000..04ea4b7e8a2
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-8.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Fib', onlyNum = 5;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-9.html b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-9.html
new file mode 100644
index 00000000000..d640b3f73dd
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-recursive-9.html
@@ -0,0 +1,49 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Tak', onlyNum = 5;
+function thisTest() {
+
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+	if (y >= x) return z;
+	return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+startTest("real-recursive");
+
+for ( var i = 3; i <= 6; i++ ) (function(i){
+
+	test("Ack", i, function(){
+		ack(3,i);
+	});
+	
+	test("Fib", i, function(){
+		fib(10.0+i);
+	});
+	
+	test("Tak", i, function(){
+		tak(3*i,2*i,i);
+	});
+
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-1.html b/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-1.html
new file mode 100644
index 00000000000..6afb26fae24
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-1.html
@@ -0,0 +1,67 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Spectral Norm', onlyNum = 8;
+function thisTest() {
+
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by Ian Osgood
+
+function A(i,j) {
+  return 1/((i+j)*(i+j+1)/2+i+1);
+}
+
+function Au(u,v) {
+  for (var i=0; i<u.length; ++i) {
+    var t = 0;
+    for (var j=0; j<u.length; ++j)
+      t += A(i,j) * u[j];
+    v[i] = t;
+  }
+}
+
+function Atu(u,v) {
+  for (var i=0; i<u.length; ++i) {
+    var t = 0;
+    for (var j=0; j<u.length; ++j)
+      t += A(j,i) * u[j];
+    v[i] = t;
+  }
+}
+
+function AtAu(u,v,w) {
+  Au(u,w);
+  Atu(w,v);
+}
+
+function spectralnorm(n) {
+  var i, u=[], v=[], w=[], vv=0, vBv=0;
+  for (i=0; i<n; ++i) {
+    u[i] = 1; v[i] = w[i] = 0;
+  }
+  for (i=0; i<10; ++i) {
+    AtAu(u,v,w);
+    AtAu(v,u,w);
+  }
+  for (i=0; i<n; ++i) {
+    vBv += u[i]*v[i];
+    vv  += v[i]*v[i];
+  }
+  return Math.sqrt(vBv/vv);
+}
+
+startTest("real-spectral-norm");
+
+for ( var i = 8; i <= 64; i *= 2 ) (function(i){
+  test( "Spectral Norm", i, function(){
+    spectralnorm(i);
+  });
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-2.html b/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-2.html
new file mode 100644
index 00000000000..5724cb2edc1
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-2.html
@@ -0,0 +1,67 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Spectral Norm', onlyNum = 16;
+function thisTest() {
+
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by Ian Osgood
+
+function A(i,j) {
+  return 1/((i+j)*(i+j+1)/2+i+1);
+}
+
+function Au(u,v) {
+  for (var i=0; i<u.length; ++i) {
+    var t = 0;
+    for (var j=0; j<u.length; ++j)
+      t += A(i,j) * u[j];
+    v[i] = t;
+  }
+}
+
+function Atu(u,v) {
+  for (var i=0; i<u.length; ++i) {
+    var t = 0;
+    for (var j=0; j<u.length; ++j)
+      t += A(j,i) * u[j];
+    v[i] = t;
+  }
+}
+
+function AtAu(u,v,w) {
+  Au(u,w);
+  Atu(w,v);
+}
+
+function spectralnorm(n) {
+  var i, u=[], v=[], w=[], vv=0, vBv=0;
+  for (i=0; i<n; ++i) {
+    u[i] = 1; v[i] = w[i] = 0;
+  }
+  for (i=0; i<10; ++i) {
+    AtAu(u,v,w);
+    AtAu(v,u,w);
+  }
+  for (i=0; i<n; ++i) {
+    vBv += u[i]*v[i];
+    vv  += v[i]*v[i];
+  }
+  return Math.sqrt(vBv/vv);
+}
+
+startTest("real-spectral-norm");
+
+for ( var i = 8; i <= 64; i *= 2 ) (function(i){
+  test( "Spectral Norm", i, function(){
+    spectralnorm(i);
+  });
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-3.html b/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-3.html
new file mode 100644
index 00000000000..3e4c83785e6
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-3.html
@@ -0,0 +1,67 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Spectral Norm', onlyNum = 32;
+function thisTest() {
+
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by Ian Osgood
+
+function A(i,j) {
+  return 1/((i+j)*(i+j+1)/2+i+1);
+}
+
+function Au(u,v) {
+  for (var i=0; i<u.length; ++i) {
+    var t = 0;
+    for (var j=0; j<u.length; ++j)
+      t += A(i,j) * u[j];
+    v[i] = t;
+  }
+}
+
+function Atu(u,v) {
+  for (var i=0; i<u.length; ++i) {
+    var t = 0;
+    for (var j=0; j<u.length; ++j)
+      t += A(j,i) * u[j];
+    v[i] = t;
+  }
+}
+
+function AtAu(u,v,w) {
+  Au(u,w);
+  Atu(w,v);
+}
+
+function spectralnorm(n) {
+  var i, u=[], v=[], w=[], vv=0, vBv=0;
+  for (i=0; i<n; ++i) {
+    u[i] = 1; v[i] = w[i] = 0;
+  }
+  for (i=0; i<10; ++i) {
+    AtAu(u,v,w);
+    AtAu(v,u,w);
+  }
+  for (i=0; i<n; ++i) {
+    vBv += u[i]*v[i];
+    vv  += v[i]*v[i];
+  }
+  return Math.sqrt(vBv/vv);
+}
+
+startTest("real-spectral-norm");
+
+for ( var i = 8; i <= 64; i *= 2 ) (function(i){
+  test( "Spectral Norm", i, function(){
+    spectralnorm(i);
+  });
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-4.html b/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-4.html
new file mode 100644
index 00000000000..5c754f62f34
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/real-spectral-norm-4.html
@@ -0,0 +1,67 @@
+<html><head>
+<!-- MOZ_INSERT_CONTENT_HOOK -->
+<script src = runner.js></script>
+<script>
+var onlyName = 'Spectral Norm', onlyNum = 64;
+function thisTest() {
+
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by Ian Osgood
+
+function A(i,j) {
+  return 1/((i+j)*(i+j+1)/2+i+1);
+}
+
+function Au(u,v) {
+  for (var i=0; i<u.length; ++i) {
+    var t = 0;
+    for (var j=0; j<u.length; ++j)
+      t += A(i,j) * u[j];
+    v[i] = t;
+  }
+}
+
+function Atu(u,v) {
+  for (var i=0; i<u.length; ++i) {
+    var t = 0;
+    for (var j=0; j<u.length; ++j)
+      t += A(j,i) * u[j];
+    v[i] = t;
+  }
+}
+
+function AtAu(u,v,w) {
+  Au(u,w);
+  Atu(w,v);
+}
+
+function spectralnorm(n) {
+  var i, u=[], v=[], w=[], vv=0, vBv=0;
+  for (i=0; i<n; ++i) {
+    u[i] = 1; v[i] = w[i] = 0;
+  }
+  for (i=0; i<10; ++i) {
+    AtAu(u,v,w);
+    AtAu(v,u,w);
+  }
+  for (i=0; i<n; ++i) {
+    vBv += u[i]*v[i];
+    vv  += v[i]*v[i];
+  }
+  return Math.sqrt(vBv/vv);
+}
+
+startTest("real-spectral-norm");
+
+for ( var i = 8; i <= 64; i *= 2 ) (function(i){
+  test( "Spectral Norm", i, function(){
+    spectralnorm(i);
+  });
+})(i);
+
+endTest();
+}
+</script>
+<body onload="thisTest()"></body></html>
\ No newline at end of file
diff --git a/mozilla/testing/performance/talos/page_load_test/jss/runner.js b/mozilla/testing/performance/talos/page_load_test/jss/runner.js
new file mode 100644
index 00000000000..c00524a6573
--- /dev/null
+++ b/mozilla/testing/performance/talos/page_load_test/jss/runner.js
@@ -0,0 +1,172 @@
+(function(){
+
+	// Figure out if we need to stagger the tests, or not
+	var doDelay = typeof window != "undefined" && window.location && window.location.search == "?delay";
+
+	// Get the output pre (if it exists, and if we're embedded in a runner page)
+	var pre = typeof document != "undefined" && document.getElementsByTagName &&
+		document.getElementsByTagName("pre")[0];
+	
+	// The number of iterations to do
+	// and the number of seconds to wait for a timeout
+	var numTests = 100, timeout = !doDelay ? 20000 : 4500;
+
+	var title, testName, summary = 0, queue = [];
+
+	// Initialize a batch of tests
+	//  name = The name of the test collection
+	this.startTest = function(name){
+		testName = name;
+
+		if ( typeof onlyName == "undefined" )
+			log([ "__start_report", testName ]);
+	};
+
+	// End the tests and finalize the report
+	this.endTest = function(){
+		// Save the summary output until all the test are complete
+		queue.push(function(){
+			if ( typeof onlyName == "undefined" ) {
+				log([ "__summarystats", summary ]);
+				log([ "__end_report" ]);
+
+			// Log the time to the special Talos function, if it exists
+			} else if ( typeof tpRecordTime != "undefined" )
+				tpRecordTime( summary );
+
+			// Otherwise, we're only interested in the results from a single function
+			else
+				log([ "__start_report" + summary + "__end_report" ]);
+
+			// Force an application quit (for the Mozilla perf test runner)
+			if ( typeof goQuitApplication != "undefined" )
+				goQuitApplication();
+		});
+
+		// Start running the first test
+		dequeue();
+	};
+
+	// Run a new test
+	//  name = The unique name of the test
+	//  num = The 'length' of the test (length of string, # of tests, etc.)
+	//  fn = A function holding the test to run
+	this.test = function(name, num, fn){
+		// Done't run the test if we're limiting to just one
+		if ( typeof onlyName == "undefined" || (name == onlyName && num == onlyNum) ) {
+			// Don't execute the test immediately
+			queue.push(function(){
+				doTest( name, num, fn );
+			});
+		}
+	};
+
+	// The actual testing function (only to be called via the queue control)
+	function doTest(name, num, fn){
+		title = name;
+		var times = [], start, diff, sum = 0, min = -1, max = -1,
+			median, std, mean;
+		
+		if ( !fn ) {
+			fn = num;
+			num = '';
+		}
+
+		// run tests
+		try {
+			// We need to let the test time out
+			var testStart = (new Date()).getTime();
+			
+			for ( var i = 0; i < numTests; i++ ) {
+				start = (new Date()).getTime();
+				fn();
+				var cur = (new Date()).getTime();
+				diff = cur - start;
+				
+				// Make Sum
+				sum += diff;
+				
+				// Make Min
+				if ( min == -1 || diff < min )
+				  min = diff;
+				  
+				// Make Max
+				if ( max == -1 || diff > max )
+				  max = diff;
+				  
+				// For making Median and Variance
+				times.push( diff );
+					
+				// Check to see if the test has run for too long
+				if ( timeout > 0 && cur - testStart > timeout )
+					break;
+			}
+		} catch( e ) {
+			if ( typeof onlyName == "undefined" )
+				return log( [ title, num, NaN, NaN, NaN, NaN, NaN ] );
+			else
+				return log( [ "__FAIL" + e + "__FAIL" ] );
+		}
+
+		// Make Mean
+		mean = sum / times.length;
+		
+		// Keep a running summary going
+		summary += mean;
+		
+		// Make Median
+		times = times.sort(function(a,b){
+			return a - b;
+		});
+		
+		if ( times.length % 2 == 0 )
+			median = (times[(times.length/2)-1] + times[times.length/2]) / 2;
+		else
+			median = times[(times.length/2)];
+		
+		// Make Variance
+		var variance = 0;
+		for ( var i = 0; i < times.length; i++ )
+			variance += Math.pow(times[i] - mean, 2);
+		variance /= times.length - 1;
+		
+		// Make Standard Deviation
+		std = Math.sqrt( variance );
+
+		if ( typeof onlyName == "undefined" )
+			log( [ title, num, median, mean, min, max, std ] );
+
+		// Execute the next test
+		dequeue();
+	};
+
+	// Remove the next test from the queue and execute it
+	function dequeue(){
+		// If we're in a browser, and the user wants to delay the tests,
+		// then we should throw it in a setTimeout
+		if ( doDelay && typeof setTimeout != "undefined" )
+			setTimeout(function(){
+				queue.shift()();
+			}, 13);
+
+		// Otherwise execute the test immediately
+		else
+			queue.shift()();
+	}
+
+	// Log the results
+	function log( arr ) {
+		// If we're in an embedded runner, output to the output pre
+		if ( pre )
+			pre.innerHTML += arr.join(":") + "\n";
+
+		// Otherwise, just document.write out the results
+		else if ( typeof document != "undefined" && document.write && !doDelay )
+			document.write( arr.join(":") + "\n" );
+
+		// Otherwise, we're probably in a shell of some sort
+		else if ( typeof window == "undefined" && typeof print != "undefined" )
+			print( arr.join(":") );
+	}
+
+})();
diff --git a/mozilla/testing/performance/talos/sample.config b/mozilla/testing/performance/talos/sample.config
index 88d66a4cd93..db86b092373 100755
--- a/mozilla/testing/performance/talos/sample.config
+++ b/mozilla/testing/performance/talos/sample.config
@@ -115,4 +115,10 @@ tests :
     cycles : 1
     win_counters: []
     unix_counters : []
+  tjss:
+    url: '-tp page_load_test/jss/jss.manifest -tpchrome -tpformat tinderbox -tpcycles 5'
+    resolution : 1
+    cycles : 1
+    win_counters : []
+    unix_counters : []